ITGB1BP1 (NM_004763) Human Untagged Clone
CAT＃: SC322415
ITGB1BP1 (untagged)-Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 1
CNY 3600.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ICAP-1A; ICAP-1alpha; ICAP-1B; ICAP1; ICAP1A; ICAP1B |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322415
ACGGGAGTAGCTGCCTGGGCGCCAAAGGCCGCGGCACTCCCACGCGGACCCCGAAGTCCG
CAACCCGGGGATGGGCCCGCGGCTGCGAGGGGATCTTCTCTGGATCAAGCAATGGTGGTG AAAAATGTTTCGCAAGGGCAAAAAACGACACAGTAGTAGCAGTTCCCAAAGTAGCGAAAT CAGTACTAAGAGCAAGTCTGTGGATTCTAGCCTTGGGGGTCTTTCACGATCCAGCACTGT GGCCAGCCTCGACACAGATTCCACCAAAAGCTCAGGACAAAGCAACAATAATTCAGATAC CTGTGCAGAATTTCGAATAAAATATGTTGGTGCCATTGAGAAACTGAAACTCTCCGAGGG AAAAGGCCTTGAAGGGCCATTAGACCTGATAAATTATATAGACGTTGCCCAGCAAGATGG AAAGTTGCCTTTTGTTCCTCCGGAGGAAGAATTTATTATGGGAGTTTCCAAGTATGGCAT AAAAGTATCAACATCAGATCAATATGATGTTTTGCACAGGCATGCTCTCTACTTAATAAT CCGGATGGTGTGTTACGATGACGGTCTGGGGGTGGGAAAAAGCTTACTGGCTCTGAAGAC CACAGATGCAAGCAATGAGGAATACAGCCTGTGGGTTTATCAGTGCAACAGCCTGGAACA AGCACAAGCCATTTGCAAGGTTTTATCCACCGCTTTTGACTCTGTATTAACATCTGAGAA ACCCTGAATCCTGCAATCAAGTAGAAGTCAACTTCATCTGAAAGTTCAGCTGTTTTCAAA CTGCAATGCTGAAATGTTATGCAAATAATGAAGTTATCCCTTGCTCTAGATTTTCTGAAG AAAATGGATTGTGTAAAATGCTGATCATTTGTTTATTAAAATGTGTCCTATTAAAAAAAA AAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004763 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004763.3, NP_004754.1 |
| RefSeq Size | 1930 bp |
| RefSeq ORF | 603 bp |
| Locus ID | 9270 |
| UniProt ID | O14713 |
| Domains | PID |
| Gene Summary | The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. Variants 1, 3, 4, and 5 all encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201963 | ITGB1BP1 (Myc-DDK-tagged)-Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 1 |
CNY 3600.00 |
|
| RC201963L3 | Lenti ORF clone of Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201963L4 | Lenti ORF clone of Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG201963 | ITGB1BP1 (tGFP-tagged) - Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 1 |
CNY 5200.00 |
|
| SC117162 | ITGB1BP1 (untagged)-Human integrin beta 1 binding protein 1 (ITGB1BP1), transcript variant 1 |
CNY 3600.00 |
其它ITGB1BP1产品
