MRPL40 (NM_003776) Human Untagged Clone
CAT#: SC322398
MRPL40 (untagged)-Human mitochondrial ribosomal protein L40 (MRPL40), nuclear gene encoding mitochondrial protein
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | L40mt; MRP-L22; MRP-L40; MRPL22; NLVCF; URIM |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322398
GGACTGTGGAGGGGCGCACGCCCGGAAGCGGCGAGGGTAGCCATGACGGCCTCCGTGCTG
CGAAGTATCTCGCTAGCCCTGCGCCCGACTAGCGGGCTTCTGGGAACTTGGCAGACGCAG CTTAGAGAGACTCACCAGCGAGCGTCATTGTTGTCTTTCTGGGAACTCATTCCCATGAGA TCAGAACCTCTTCGAAAAAAGAAGAAGGTAGATCCTAAAAAAGACCAAGAAGCAAAGGAG CGCTTGAAAAGGAAGATCCGAAAACTGGAAAAGGCTACTCAAGAGCTAATTCCTATTGAA GATTTTATTACCCCTCTAAAGTTCTTGGATAAAGCAAGAGAGCGGCCTCAGGTGGAGCTC ACCTTTGAGGAGACTGAGAGGAGAGCTCTGCTTCTGAAGAAGTGGTCCTTGTACAAGCAG CAAGAGCGTAAGATGGAGAGGGACACCATCAGGGCTATGCTAGAAGCCCAGCAGGAAGCT CTGGAGGAACTGCAACTGGAATCCCCGAAGCTCCATGCTGAGGCCATCAAGCGGGATCCT AACCTGTTCCCCTTTGAGAAGGAAGGGCCACATTACACACCACCGATCCCTAACTACCAA CCCCCTGAAGGCAGGTACAATGACATCACCAAGGTGTACACACAAGTGGAGTTTAAGAGA TAGACTTGCAGGCTGCTATCCTTAACATGCTGCCCCTGAGAGTAGGAATGACCAGGGTTC AAGTCTGCTTTCCACAGAATCAGGCATGCTGTTAATAAATACTGGTTTAATCAAAAAAAA AAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003776 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003776.2, NP_003767.2 |
RefSeq Size | 787 bp |
RefSeq ORF | 621 bp |
Locus ID | 64976 |
UniProt ID | Q9NQ50 |
Gene Summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Deletions in this gene may contribute to the etiology of velo-cardio-facial syndrome and DiGeorge syndrome. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202166 | MRPL40 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L40 (MRPL40), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
RC202166L3 | Lenti ORF clone of Human mitochondrial ribosomal protein L40 (MRPL40), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
RC202166L4 | Lenti ORF clone of Human mitochondrial ribosomal protein L40 (MRPL40), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
RG202166 | MRPL40 (tGFP-tagged) - Human mitochondrial ribosomal protein L40 (MRPL40), nuclear gene encoding mitochondrial protein |
CNY 4000.00 |
|
SC117758 | MRPL40 (untagged)-Human mitochondrial ribosomal protein L40 (MRPL40), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |