NOLA1 (GAR1) (NM_018983) Human Untagged Clone
CAT#: SC322211
GAR1 (untagged)-Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NOLA1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322211
CCGCTGTTATACGTCACTTCCACGGCTCAGCGTCAGGGAGGAGAGAGAATGTCTTTTCGA
GGCGGAGGTCGTGGAGGCTTTAATCGAGGTGGTGGAGGTGGCGGCTTCAACCGAGGCGGC AGCAGCAACCACTTCCGAGGTGGAGGCGGCGGTGGAGGCGGCGGCAATTTCAGAGGCGGC GGCAGGGGAGGATTTGGACGAGGGGGTGGCCGCGGAGGCTTTAACAAAGGCCAAGACCAA GGACCTCCAGAACGTGTAGTCTTATTAGGAGAGTTCCTGCATCCCTGTGAAGATGACATA GTTTGTAAATGTACCACAGATGAAAATAAGGTGCCTTATTTCAATGCTCCTGTTTACTTA GAAAACAAAGAACAAATTGGAAAAGTGGATGAAATATTTGGACAACTCAGAGATTTTTAT TTTTCAGTTAAGTTGTCAGAAAACATGAAGGCTTCATCCTTTAAAAAACTACAGAAGTTT TATATAGACCCATATAAGCTGCTGCCACTGCAGAGGTTTTTACCTCGACCTCCAGGTGAG AAAGGACCTCCAAGAGGTGGTGGCAGGGGAGGCCGAGGAGGAGGAAGAGGAGGAGGTGGC AGAGGTGGTGGCAGAGGTGGTGGTTTTAGAGGTGGAAGAGGAGGTGGAGGTGGGGGCTTC AGAGGAGGAAGAGGTGGTGGTTTCAGAGGGAGAGGACATTAAGTGAAACAGTTGACAGAC ATCACCAGTTGACTTCTGCATTAACCTGCATGATCTGTTTCTACTATGGATTGGAAACTT GTTTCTTGAACAAGTCTTGAAGATCTTGGTCATTTTATGACAATGGATCTAAAATGTCAG CATCATGCAAAGTGCAACGGAATAGTGAATTTTGCTCTAAAAGAGCATGAACAAGTCTTT CTAATGTTTTGTACAGTGCCTGGCACTCTGTGGGTGCTCAATAAATGGATAGGAGTTTTC ATTTGAAGCATATTTGAATTTTTAAAATAAAGTGTTTTATTCCCTTAAAAAAAAAAAAAA A |
| Restriction Sites | Please inquire |
| ACCN | NM_018983 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_018983.3, NP_061856.1 |
| RefSeq Size | 1280 bp |
| RefSeq ORF | 654 bp |
| Locus ID | 54433 |
| UniProt ID | Q9NY12 |
| Domains | Gar1 |
| Protein Families | Stem cell - Pluripotency |
| Gene Summary | This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) contains a region of additional sequence in the 5' UTR when compared to variant 2. The encoded protein is identical for both transcript variants. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201481 | GAR1 (Myc-DDK-tagged)-Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 1 |
CNY 2400.00 |
|
| RC201481L3 | Lenti ORF clone of Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201481L4 | Lenti ORF clone of Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG201481 | GAR1 (tGFP-tagged) - Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 1 |
CNY 4000.00 |
|
| SC111294 | GAR1 (untagged)-Human GAR1 ribonucleoprotein homolog (yeast) (GAR1), transcript variant 1 |
CNY 2400.00 |
