MGMT (NM_002412) Human Untagged Clone
CAT#: SC322190
MGMT (untagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT)
CNY 3600.00
Cited in 2 publications. |
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322190
GACGCCCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGGTACTTGGAAAAATGGACA
AGGATTGTGAAATGAAACGCACCACACTGGACAGCCCTTTGGGGAAGCTGGAGCTGTCTG GTTGTGAGCAGGGTCTGCACGAAATAAAGCTCCTGGGCAAGGGGACGTCTGCAGCTGATG CCGTGGAGGTCCCAGCCCCCGCTGCGGTTCTCGGAGGTCCGGAGCCCCTGATGCAGTGCA CAGCCTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGG CTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGC TGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCA ACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCA TCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGG CCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAG GGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGC CTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTAA CACTGCATCGGATGCGGGGCGTGGAGGCACCGCTGTATTAAAGGAAGTGGCAGTGTCCTG GGAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002412 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002412.2, NP_002403.1 |
RefSeq Size | 1265 bp |
RefSeq ORF | 624 bp |
Locus ID | 4255 |
UniProt ID | P16455 |
Domains | Methyltransf_1 |
Protein Families | Druggable Genome |
Gene Summary | Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
The O6-methyguanine-DNA methyltransferase inhibitor O6-benzylguanine enhanced activity of temozolomide + irinotecan against models of high-risk neuroblastoma
,Hindle, A;Koneru, B;Makena, MR;Lopez-Barcons, L;Chen, WH;Nguyen, TH;Reynolds, CP;,
Anti-cancer drugs
,PubMed ID 33323683
[MGMT]
|
Thioridazine inhibits autophagy and sensitizes glioblastoma cells to temozolomide
,Johannessen, TA;Hasan-Olive, MAM;Zhu, H;Denisova, O;Grudic, A;Latif, M;Saed, H;Varughese, JK;Røsland, GV;Yang, N;Sundstrøm, T;Nordal, A;Tronstad, KJ;Wang, J;Lund-Johansen, M;Simonsen, A;Janji, B;Westermarck, J;Bjerkvig, R;Prestegarden, L;,
Int. J. Cancer
,PubMed ID 30289977
[MGMT]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201612 | MGMT (Myc-DDK-tagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT) |
CNY 3600.00 |
|
RC201612L1 | Lenti ORF clone of Human O-6-methylguanine-DNA methyltransferase (MGMT), Myc-DDK-tagged |
CNY 5890.00 |
|
RC201612L3 | Lenti ORF clone of Human O-6-methylguanine-DNA methyltransferase (MGMT), Myc-DDK-tagged |
CNY 6000.00 |
|
RC229131 | MGMT (Myc-DDK-tagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT) |
CNY 3600.00 |
|
RC229131L1 | Lenti ORF clone of Human O-6-methylguanine-DNA methyltransferase (MGMT), Myc-DDK-tagged |
CNY 6000.00 |
|
RC229131L2 | Lenti ORF clone of Human O-6-methylguanine-DNA methyltransferase (MGMT), mGFP tagged |
CNY 5890.00 |
|
RC229131L3 | Lenti ORF clone of Human O-6-methylguanine-DNA methyltransferase (MGMT), Myc-DDK-tagged |
CNY 5890.00 |
|
RC229131L4 | Lenti ORF clone of Human O-6-methylguanine-DNA methyltransferase (MGMT), mGFP tagged |
CNY 6000.00 |
|
RG201612 | MGMT (tGFP-tagged) - Human O-6-methylguanine-DNA methyltransferase (MGMT) |
CNY 4370.00 |
|
RG229131 | MGMT (tGFP-tagged) - Human O-6-methylguanine-DNA methyltransferase (MGMT) |
CNY 5200.00 |
|
SC108494 | MGMT (untagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT) |
CNY 3600.00 |
|
SC327766 | MGMT (untagged)-Human O-6-methylguanine-DNA methyltransferase (MGMT) |
CNY 3600.00 |