DLK2 (NM_023932) Human Untagged Clone

CAT#: SC322054

DLK2 (untagged)-Human delta-like 2 homolog (Drosophila) (DLK2), transcript variant 1



  "NM_023932" in other vectors (4)

CNY 3656.00

CNY 7220.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DLK2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DLK-2; EGFL9
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_023932, the custom clone sequence may differ by one or more nucleotides


ATGCCCAGCGGCTGCCGCTGCCTGCATCTCGTGTGCCTGTTGTGCATTCTGGGGGCTCCCGGTCAGCCTG
TCCGAGCCGATGACTGCAGCTCCCACTGTGACCTGGCCCACGGCTGCTGTGCACCTGACGGCTCCTGCAG
GTGTGACCCGGGCTGGGAGGGGCTGCACTGTGAGCGCTGTGTGAGGATGCCTGGCTGCCAGCACGGTACC
TGCCACCAGCCATGGCAGTGCATCTGCCACAGTGGCTGGGCAGGCAAGTTCTGTGACAAAGATGAACATA
TCTGTACCACGCAGTCCCCCTGCCAGAATGGAGGCCAGTGCATGTATGACGGGGGCGGTGAGTACCATTG
TGTGTGCTTACCAGGCTTCCATGGGCGTGACTGCGAGCGCAAGGCTGGACCCTGTGAACAGGCAGGCTCC
CCATGCCGCAATGGCGGGCAGTGCCAGGACGACCAGGGCTTTGCTCTCAACTTCACGTGCCGCTGCTTGG
TGGGCTTTGTGGGTGCCCGCTGTGAGGTAAATGTGGATGACTGCCTGATGCGGCCTTGTGCTAACGGTGC
CACCTGCCTTGACGGCATAAACCGCTTCTCCTGCCTCTGTCCTGAGGGCTTTGCTGGACGCTTCTGCACC
ATCAACCTGGATGACTGTGCCAGCCGCCCATGCCAGAGAGGGGCCCGCTGTCGGGACCGTGTCCACGACT
TCGACTGCCTCTGCCCCAGTGGCTATGGTGGCAAGACCTGTGAGCTTGTCTTACCTGTCCCAGACCCCCC
AACCACAGTGGACACCCCTCTAGGGCCCACCTCAGCTGTAGTGGTACCTGCCACGGGGCCAGCCCCCCAC
AGCGCAGGGGCTGGTCTGCTGCGGATCTCAGTGAAGGAGGTGGTGCGGAGGCAAGAGGCTGGGCTAGGTG
AGCCTAGCTTGGTGGCCCTGGTGGTGTTTGGGGCCCTCACTGCTGCCCTGGTTCTGGCTACTGTGTTGCT
GACCCTGAGGGCCTGGCGCCGGGGTGTCTGCCCCCCTGGACCCTGTTGCTACCCTGCCCCACACTATGCT
CCAGCGTGCCAGGACCAGGAGTGTCAGGTTAGCATGCTGCCAGCAGGGCTCCCCCTGCCACGTGACTTGC
CCCCTGAGCCTGGAAAGACCACAGCACTGTGA


Restriction Sites Please inquire     
ACCN NM_023932
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_023932.2, NP_076421.2
RefSeq Size 1574 bp
RefSeq ORF 1152 bp
Locus ID 65989
UniProt ID Q6UY11
Protein Families Druggable Genome, Transmembrane
Gene Summary Regulates adipogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) differs in the 5' UTR, compared to variant 2. Both variants 1 and 2 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...