HLA-DRB3 (NM_022555) Human Untagged Clone
CAT#: SC322032
HLA (untagged)-Human major histocompatibility complex, class II, DR beta 3 (HLA-DRB3)
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DRB3; HLA-DPB1; HLA-DR1B; HLA-DR3B; HLA-DRB3* |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322032
GACCCACGCGTCCGCGGACGCGTGGGTCGACCCACGCGTCCGGACCCACGCGTCCGGAGA
CTTGCCTGCTCCTCTGGCCCCTGGTCCTGTCCTCTTCTCCAGCATGGTGTGTCTGAAGCT CCCTGGAGGCTCCAGCTTGGCAGCGTTGACAGTGACACTGATGGTGCTGAGCTCCCGACT GGCTTTCGCTGGGGACACCCGACCACGTTTCTTGGAGCTGCTTAAGTCTGAGTGTCATTT CTTCAATGGGACGGAGCGGGTGCGGTTCCTGGAGAGACACTTCCATAACCAGGAGGAGTA CGCGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGAGGGAGCTGGGGCGGCCTGA TGCCGAGTACTGGAACAGCCAGAAGGACCTCCTGGAGCAGAAGCGGGGCCAGGTGGACAA TTACTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACAGTGCAGCGGCGAGTCCATCC TCAGGTGACTGTGTATCCTGCAAAGACCCAGCCCCTGCAGCACCACAACCTCCTGGTCTG CTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGA AGAGAAGGCTGGGGTGGTGTCCACGGGCCTGATCCAGAATGGAGACTGGACCTTCCAGAC CCTGGTGATGCTAGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCA CCCAAGCGTAACGAGCCCTCTCACAGTGGAATGGAGTGCACGGTCTGAATCTGCACAGAG CAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCT GTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAGCCAACAGGATTCCTGAG CTGAAGTGCAGATGACAATTTAAGGAAGAATCTTCTTCCCCAGCTTTGCAGGATGAAAAG CTTTCCCGCCTGGCTGTTATTCTTCCACGAGAGAGGGCTTTCTCAGGACCTAGTTGCTAC TGGTTCAGCAACTGCAGAAAATGTCCTCCCTTGTGGCTTCCTCAGTTCCTGCCCTTGGCC TGAAGTCCCAGCATTGATGGCAGCGCCTCATCTTCAACTTTTGTGCTCCCCTTTGCCTAA ACCCTATGGCCTCCTGTGCATCTGTACTCACCCTGTACCACAAACACATTACATTATTAA ATGTTTCTCAAAGATGGAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_022555 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_022555.3, NP_072049.2 |
| RefSeq Size | 1158 bp |
| RefSeq ORF | 801 bp |
| Locus ID | 3125 |
| UniProt ID | P79483 |
| Domains | MHC_II_beta, ig, IGc1 |
| Protein Families | Transmembrane |
| Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Hematopoietic cell lineage, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
| Gene Summary | HLA-DRB3 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. There are multiple pseudogenes of this gene. [provided by RefSeq, Feb 2020] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210732 | HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DR beta 3 (HLA-DRB3) |
CNY 2400.00 |
|
| RC210732L3 | Lenti-ORF clone of HLA (Myc-DDK-tagged)-Human major histocompatibility complex, class II, DR beta 3 (HLA-DRB3) |
CNY 5890.00 |
|
| RC210732L4 | Lenti-ORF clone of HLA (mGFP-tagged)-Human major histocompatibility complex, class II, DR beta 3 (HLA-DRB3) |
CNY 5890.00 |
|
| RG210732 | HLA (tGFP-tagged) - Human major histocompatibility complex, class II, DR beta 3 (HLA-DRB3) |
CNY 4000.00 |
|
| SC112463 | HLA (untagged)-Human major histocompatibility complex, class II, DR beta 3 (HLA-DRB3) |
CNY 2400.00 |
其它HLA-DRB3产品
