VPS28 (NM_183057) Human Untagged Clone
CAT#: SC321875
VPS28 (untagged)-Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_183057.1
CTTCCCGACCGCGAGCCGTCCAGGTCTCAGTGCTGTGCCCCCCCCAGAGCCTAGAGGATG
TTTCATGGGATCCCAGCCACGCCGGGCATAGGAGCCCCTGGGAACAAGCCGGAGCTGTAT GAGGAAGTGAAGTTGTACAAGAACGCCCGGGAGAGGGAGAAGTACGACAACATGGCAGAG CTGTTTGCGGTGGTGAAGACAATGCAAGCCCTGGAGAAGGCCTACATCAAGGACTGTGTC TCCCCCAGCGAGTACACTGCAGCCTGCTCCCGGCTCCTGGTCCAATACAAAGCTGCCTTC AGGCAGGTCCAGGGCTCAGAAATCAGCTCTATTGACGAATTCTGCCGCAAGTTCCGCCTG GACTGCCCGCTGGCCATGGAGCGGATCAAGGAGGACCGGCCCATCACCATCAAGGACGAC AAGGGCAACCTCAACCGCTGCATCGCAGACGTGGTCTCGCTCTTCATCACGGTCATGGAC AAGCTGCGCCTGGAGATCCGCGCCATGGATGAGATCCAGCCCGACCTGCGAGAGCTGATG GAGACCATGCACCGCATGAGCCACCTCCCACCCGACTTTGAGGGCCGCCAGACGGTCAGC CAGTGGTGGGTGTCCCTCCCAGCCAGGCAGAGCCCCGCAGTGCCCGAGACCCTCCCAGCC AGGCGGAGCCCCGCAGTGCCCCTGAGGCCCTCAGCCCCCACATGCCCTGTGCTGCACTCC CAGGCTGCAGACCCTGAGCGGCATGTCGGCGTCAGATGAGCTGGACGACTCACAGGTGCG TCAGATGCTGTTCGACCTGGAGTCAGCCTACAACGCCTTCAACCGCTTCCTGCATGCCTG AGCCCGGGGCACTAGCCCTTGCACAGAAGGGCAGAGTCTGAGGCGATGGCTCCTGGTCCC CTGTCCGCCACACAGGCCGTGGTCATCCACACAACTCACTGTCTGCAGCTGCCTGTCTGG TGTCTGTCTTTGGTGTCAGAACTTTGGGGGCCGGGCCCCTCCCCACAATAAAGATGCTCT CCGACCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_183057 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_183057.1, NP_898880.1 |
RefSeq Size | 1160 bp |
RefSeq ORF | 702 bp |
Locus ID | 51160 |
UniProt ID | Q9UK41 |
Protein Pathways | Endocytosis |
Gene Summary | This gene encodes a protein subunit of the ESCRT-I complex (endosomal complexes required for transport), which functions in the transport and sorting of proteins into subcellular vesicles. This complex can also be hijacked to facilitate the budding of enveloped viruses from the cell membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) contains an alternate segment in ther 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is longer and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208726 | VPS28 (Myc-DDK-tagged)-Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2 |
CNY 2400.00 |
|
RC208726L1 | Lenti ORF clone of Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC208726L2 | Lenti ORF clone of Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC208726L3 | Lenti ORF clone of Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC208726L4 | Lenti ORF clone of Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG208726 | VPS28 (tGFP-tagged) - Human vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28), transcript variant 2 |
CNY 4000.00 |