HCST (NM_014266) Human Untagged Clone
CAT#: SC321835
HCST (untagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 1
CNY 1200.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DAP10; KAP10; PIK3AP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_014266.3
CTTGACACCAGCAGGGTGACATCCGCTATTGCTACTTCTCTGCTCCCCCACAGTTCCTCT
GGACTTCTCTGGACCACAGTCCTCTGCCAGACCCCTGCCAGACCCCAGTCCACCATGATC CATCTGGGTCACATCCTCTTCCTGCTTTTGCTCCCAGTGGCTGCAGCTCAGACGACTCCA GGAGAGAGATCATCACTCCCTGCCTTTTACCCTGGCACTTCAGGCTCTTGTTCCGGATGT GGGTCCCTCTCTCTGCCGCTCCTGGCAGGCCTCGTGGCTGCTGATGCGGTGGCATCGCTG CTCATCGTGGGGGCGGTGTTCCTGTGCGCACGCCCACGCCGCAGCCCCGCCCAAGAAGAT GGCAAAGTCTACATCAACATGCCAGGCAGGGGCTGACCCTCCTGCAGCTTGGACCTTTGA CTTCTGACCCTCTCATCCTGGATGGTGTGTGGTGGCACAGGAACCCCCGCCCCAACTTTT GGATTGTAATAAAACAATTGAAACCCCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_014266 |
| Insert Size | 282 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_014266.3, NP_055081.1 |
| RefSeq Size | 524 bp |
| RefSeq ORF | 282 bp |
| Locus ID | 10870 |
| UniProt ID | Q9UBK5 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Natural killer cell mediated cytotoxicity |
| Gene Summary | This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208290 | HCST (Myc-DDK-tagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 1 |
CNY 1200.00 |
|
| RC208290L1 | Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 1, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC208290L2 | Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC208290L3 | Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC208290L4 | Lenti ORF clone of Human hematopoietic cell signal transducer (HCST), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG208290 | HCST (tGFP-tagged) - Human hematopoietic cell signal transducer (HCST), transcript variant 1 |
CNY 2800.00 |
