Pancreatic Polypeptide (PPY) (NM_002722) Human Untagged Clone
CAT#: SC321713
PPY (untagged)-Human pancreatic polypeptide (PPY)
CNY 1800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PNP; PP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_002722.3
ATGGCTGCCGCACGCCTCTGCCTCTCCCTGCTGCTCCTGTCCACCTGCGTGGCTCTGTTA
CTACAGCCACTGCTGGGTGCCCAGGGAGCCCCACTGGAGCCAGTGTACCCAGGGGACAAT GCCACACCAGAGCAGATGGCCCAGTATGCAGCTGATCTCCGTAGATACATCAACATGCTG ACCAGGCCTAGGTATGGGAAAAGACACAAAGAGGACACGCTGGCCTTCTCGGAGTGGGGG TCCCCGCATGCTGCTGTCCCCAGGGAGCTCAGCCCGCTGGACTTATAATGCCACCTTCTG TCTCCTACGACTCCATGAGCAGCGCCAGCCCAGCTCTCCCCTCTGCACCCTTGGCTCTGG CCAAAGCTTGCTCCCTGCTCCCACACAGGCTCAATAAAGCAAGTCAAAGCCAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002722 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002722.3, NP_002713.1 |
| RefSeq Size | 457 bp |
| RefSeq ORF | 288 bp |
| Locus ID | 5539 |
| UniProt ID | P01298 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded 95 aa preproprotein is synthesized in the pancreatic islets of Langerhans and proteolytically processed to generate two peptide products. These products include the active pancreatic hormone of 36 aa and an icosapeptide of unknown function. This hormone acts as a regulator of pancreatic and gastrointestinal functions and may be important in the regulation of food intake. Plasma level of this hormone has been shown to be reduced in conditions associated with increased food intake and elevated in anorexia nervosa. In addition, infusion of this hormone in obese rodents has shown to decrease weight gain. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206584 | PPY (Myc-DDK-tagged)-Human pancreatic polypeptide (PPY) |
CNY 1800.00 |
|
| RC206584L3 | Lenti ORF clone of Human pancreatic polypeptide (PPY), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC206584L4 | Lenti ORF clone of Human pancreatic polypeptide (PPY), mGFP tagged |
CNY 5890.00 |
|
| RG206584 | PPY (tGFP-tagged) - Human pancreatic polypeptide (PPY) |
CNY 4370.00 |
其它Pancreatic Polypeptide产品
