LCN1 (NM_002297) Human Untagged Clone
CAT#: SC321635
LCN1 (untagged)-Human lipocalin 1 (tear prealbumin) (LCN1)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PMFA; TLC; TP; VEGP |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002297.2
GGGGAGCCTCTCCCAGCCCCAGCAAGCGACCTGTCAGGCGGCCGTGGACTCAGACTCCGG
AGATGAAGCCCCTGCTCCTGGCCGTCAGCCTTGGCCTCATTGCTGCCCTGCAGGCCCACC ACCTCCTGGCCTCAGACGAGGAGATTCAGGATGTGTCAGGGACGTGGTATCTGAAGGCCA TGACGGTGGACAGGGAGTTCCCTGAGATGAATCTGGAATCGGTGACACCCATGACCCTCA CGACCCTGGAAGGGGGCAACCTGGAAGCCAAGGTCACCATGCTGATAAGTGGCCGGTGCC AGGAGGTGAAGGCCGTCCTGGAGAAAACTGACGAGCCGGGAAAATACACGGCCGACGGGG GCAAGCACGTGGCATACATCATCAGGTCGCACGTGAAGGACCACTACATCTTTTACTGTG AGGGCGAGCTGCACGGGAAGCCGGTCCGAGGGGTGAAGCTCGTGGGCAGAGACCCCAAGA ACAACCTGGAAGCCTTGGAGGACTTTGAGAAAGCCGCAGGAGCCCGCGGACTCAGCACGG AGAGCATCCTCATCCCCAGGCAGAGCGAAACCTGCTCTCCAGGGAGCGATTAGGGGCAGG GGACACCTTGGCTCCTCAGCAGCCCAAGGACGGCACCATCCAGCACCTCCGTCATTCACA GGGACATGGAAAAAGCTCCCCACCCCTGCAGAACGCGGCTGGCTGCACCCCTTCCTACCA CCCCCCGCCTTCCCCCTGCCCTGCGCCCCCTCTCCTGGTTCTCCATAAAGAGCTTCAGCA GCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002297 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002297.2, NP_002288.1 |
RefSeq Size | 786 bp |
RefSeq ORF | 531 bp |
Locus ID | 3933 |
UniProt ID | P31025 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the lipocalin family of small secretory proteins. Lipocalins are extracellular transport proteins that bind to a variety of hydrophobic ligands. The encoded protein is the primary lipid binding protein in tears and is overproduced in response to multiple stimuli including infection and stress. The encoded protein may be a marker for chromosome aneuploidy as well as an autoantigen in Sjogren's syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and two pseudogenes of this gene are also located on the long arm of chromosome 9. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the shortest isoform (1). Variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209363 | LCN1 (Myc-DDK-tagged)-Human lipocalin 1 (tear prealbumin) (LCN1) |
CNY 2400.00 |
|
RC209363L1 | Lenti ORF clone of Human lipocalin 1 (tear prealbumin) (LCN1), Myc-DDK-tagged |
CNY 4800.00 |
|
RC209363L2 | Lenti ORF clone of Human lipocalin 1 (tear prealbumin) (LCN1), mGFP tagged |
CNY 5890.00 |
|
RC209363L3 | Lenti ORF clone of Human lipocalin 1 (tear prealbumin) (LCN1), Myc-DDK-tagged |
CNY 4800.00 |
|
RC209363L4 | Lenti ORF clone of Human lipocalin 1 (tear prealbumin) (LCN1), mGFP tagged |
CNY 4800.00 |
|
RG209363 | LCN1 (tGFP-tagged) - Human lipocalin 1 (tear prealbumin) (LCN1) |
CNY 4000.00 |