EIF4EL3 (EIF4E2) (NM_004846) Human Untagged Clone
CAT#: SC321530
EIF4E2 (untagged)-Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2)
CNY 2400.00
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004846.2
GGGACCCGGTGGAGCGGAAGTCACTCCCTGAGGCAGTGGCGACAGCGGCGGCGAGAGGAT
GAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGACCATGATCAGAATGAAGA AAACAGCACACAGAAAGATGGTGAGAAGGAAAAAACGGAACGAGACAAGAATCAGAGCAG TAGCAAGAGAAAGGCTGTTGTCCCTGGACCGGCAGAGCATCCCCTGCAGTACAACTACAC TTTTTGGTACTCCAGGAGAACCCCCGGCCGTCCCACGAGCTCACAGAGCTATGAACAGAA TATCAAACAGATTGGCACCTTTGCCTCTGTGGAGCAGTTCTGGAGGTTTTATAGCCACAT GGTACGTCCTGGGGACCTGACAGGCCACAGTGACTTCCATCTCTTCAAAGAAGGAATTAA ACCCATGTGGGAGGATGATGCAAATAAAAATGGTGGCAAGTGGATTATTCGGCTGCGGAA GGGCTTGGCCTCCCGTTGCTGGGAGAATCTCATTTTGGCCATGCTGGGGGAACAGTTCAT GGTTGGGGAGGAGATCTGTGGGGCTGTGGTGTCTGTCCGCTTTCAGGAAGACATTATTTC AATATGGAATAAGACTGCCAGTGACCAAGCAACCACAGCCCGAATCCGGGACACACTTCG GCGAGTGCTTAACCTACCTCCCAACACCATTATGGAATACAAAACTCACACCGACAGCAT CAAAATGCCAGGCAGGCTGGGCCCCCAAAGGCTCCTTTTTCAAAACCTCTGGAAGCCGCG GTTGAATGTGCCATGACCCTCTCCCTCTCTGGATGGCACCATCATTGAAGCTGGCGTCAT CGGAGTCTCTTGTTCTGTTGGCGTGCTACCTGGAAGATCCTTCTGTCCTGGACAAGAGGA ATTGGAAGAGCATTTTATGTTTTAAGAACAGGCTGACACGCAGCAGCTACAACAACAGCT GAGATCACTTAATAAATGGTGCTAAACTAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004846 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004846.2, NP_004837.1 |
RefSeq Size | 1014 bp |
RefSeq ORF | 738 bp |
Locus ID | 9470 |
UniProt ID | O60573 |
Domains | IF4E |
Protein Families | Transcription Factors |
Protein Pathways | Insulin signaling pathway, mTOR signaling pathway |
Gene Summary | Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:9582349, PubMed:17368478, PubMed:25624349). Acts as a repressor of translation initiation (PubMed:22751931). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (A). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201391 | EIF4E2 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2) |
CNY 3600.00 |
|
RC201391L1 | Lenti ORF clone of Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), Myc-DDK-tagged |
CNY 6000.00 |
|
RC201391L2 | Lenti ORF clone of Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), mGFP tagged |
CNY 6000.00 |
|
RC201391L3 | Lenti ORF clone of Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), Myc-DDK-tagged |
CNY 5890.00 |
|
RC201391L4 | Lenti ORF clone of Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), mGFP tagged |
CNY 5890.00 |
|
RG201391 | EIF4E2 (tGFP-tagged) - Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2) |
CNY 5200.00 |
其它EIF4EL3产品