SCAMP2 (NM_005697) Human Untagged Clone
CAT#: SC321330
SCAMP2 (untagged)-Human secretory carrier membrane protein 2 (SCAMP2)
CNY 2400.00
CNY 2950.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_005697.3
CACGAAGCGCCGCTGGGTCTGGGTGCCCGGAGGCAGCAGCGTTCGCGGAGTTCGCCCGCT
GGCCCCCGATCACCATGTCGGCTTTCGACACCAACCCCTTCGCGGACCCAGTGGATGTAA ACCCCTTCCAGGATCCCTCTGTGACCCAGCTGACCAACGCCCCGCAGGGCGGCCTGGCGG AATTCAACCCCTTCTCAGAGACAAATGCAGCGACAACAGTTCCTGTCACCCAACTCCCTG GGTCCTCACAGCCAGCGGTTCTCCAGCCATCAGTGGAACCAACCCAGCCGACCCCCCAGG CCGTGGTGTCTGCAGCCCAGGCAGGCCTGCTCCGGCAGCAGGAAGAACTGGACAGGAAAG CTGCCGAGCTGGAACGCAAGGAGCGGGAGCTGCAGAACACTGTAGCCAACTTGCATGTGA GACAGAACAACTGGCCCCCTCTGCCCTCGTGGTGCCCTGTGAAGCCCTGCTTCTATCAGG ATTTCTCCACAGAGATCCCTGCCGACTACCAGCGGATATGCAAGATGCTCTACTATCTGT GGATGTTGCATTCAGTGACTCTGTTTCTGAACCTGCTTGCCTGCCTGGCCTGGTTCTCGG GCAACAGCTCCAAGGGAGTGGACTTTGGCCTCTCCATCCTGTGGTTTCTGATCTTCACTC CCTGTGCCTTCCTTTGTTGGTACCGACCCATCTATAAGGCCTTTAGGTCCGACAACTCTT TCAGCTTCTTTGTGTTCTTCTTTGTATTTTTTTGTCAAATAGGGATCTACATCATCCAGT TGGTTGGCATCCCTGGCCTGGGGGACAGCGGTTGGATTGCAGCCCTGTCTACACTGGATA ATCATTCCCTGGCCATATCAGTCATCATGATGGTGGTGGCTGGCTTCTTCACCCTCTGTG CCGTGCTCTCAGTCTTCCTCCTGCAGCGGGTGCACTCCCTCTACCGACGGACAGGGGCCA GCTTCCAGCAGGCCCAGGAGGAGTTTTCCCAGGGCATCTTCAGCAGCAGAACCTTCCACA GAGCTGCTTCATCTGCTGCCCAAGGAGCCTTCCAGGGGAATTAGTCCTCCTCTCTTCTCT CCCCCTCAGCCTTTCTCTCGCCTGCCTTCTGAGCTGCACTTTCCGTGGGTGCCTTATGTG GTGGTGGTTGTGCCCAGCACAGACCTGGCAGGGTTCTTGCCGTGGCTCTTCCTCCTCCCT CAGCGACCAGCTCTCCCTGGAACGGGAGGGACAGGGAATTTTTTCCCCCTCTATGTACAA AAAAAAACAAAGCTCTCTTTCCTTCTCTGGTAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005697 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005697.3, NP_005688.2 |
| RefSeq Size | 1313 bp |
| RefSeq ORF | 990 bp |
| Locus ID | 10066 |
| UniProt ID | O15127 |
| Domains | SCAMP |
| Protein Families | Transmembrane |
| Gene Summary | This gene product belongs to the SCAMP family of proteins which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that the SCAMPs may function at the same site during vesicular transport rather than in separate pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) lacks a exon in the central coding region compared to variant 1. The encoded isoform (2) is sorter than isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200262 | SCAMP2 (Myc-DDK-tagged)-Human secretory carrier membrane protein 2 (SCAMP2) |
CNY 2400.00 |
|
| RC200262L1 | Lenti ORF clone of Human secretory carrier membrane protein 2 (SCAMP2), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC200262L2 | Lenti ORF clone of Human secretory carrier membrane protein 2 (SCAMP2), mGFP tagged |
CNY 5890.00 |
|
| RC200262L3 | Lenti ORF clone of Human secretory carrier membrane protein 2 (SCAMP2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC200262L4 | Lenti ORF clone of Human secretory carrier membrane protein 2 (SCAMP2), mGFP tagged |
CNY 5890.00 |
|
| RG200262 | SCAMP2 (tGFP-tagged) - Human secretory carrier membrane protein 2 (SCAMP2) |
CNY 4000.00 |
