PIH1D1 (NM_017916) Human Untagged Clone
CAT#: SC321317
PIH1D1 (untagged)-Human PIH1 domain containing 1 (PIH1D1)
CNY 2400.00
CNY 2950.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MOT48; NOP17; Pih1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_017916.1
GGGTAGTGCGTCTAGAGACACATATTCCCAACGGATTTGACGATGGTGTTCGGTCTTGAA
TGGAAATGTAGTCTTAGGCCAGTCTTAGGTTTTTGAACAGGATAGTAGGTATCCGGAGTC GATTGAGGGCCAGAGCAGGCACTGGGGTTCGGATCCTGGGCAAAGTTTCCCACGTTGAGG GTCTCGAGGACGCCTAGATCTCTTTCCCAGGGCCATGGCGAACCCGAAGCTGCTGGGACT GGAGCTAAGCGAGGCGGAGGCGATCGGTGCTGATTCGGCGCGATTTGAGGAGCTGCTGCT GCAGGCCTCGAAGGAGCTCCAGCAAGCCCAGACAACCAGACCAGAATCGACACAAATCCA GCCTCAGCCTGGTTTCTGCATAAAGACCAACTCCTCGGAAGGGAAGGTTTTCATCAACAT CTGCCACTCCCCCTCTATCCCTCCTCCCGCCGACGTGACCGAGGAGGAGCTGCTTCAGAT GCTAGAGGAGGACCAAGCTGGGTTTCGCATCCCCATGAGTCTGGGAGAGCCTCATGCAGA ACTGGATGCAAAAGGCCAGGGATGTACCGCCTACGACGTAGCTGTCAACAGCGACTTCTA CCGGAGGATGCAGAACAGCGATTTCTTGCGGGAGCTCGTGATCACCATCGCCAGGGAGGG CCTTGAGGACAAATACAACTTGCAGCTGAATCCGGAATGGCGCATGATGAAGAACCGGCC ATTCATGGGCTCCATCTCGCAGCAGAACATCCGCTCGGAGCAGCGTCCTCGGATCCAGGA GCTGGGGGACCTGTACACGCCCGCCCCCGGGAGAGCTGAGTCAGGCCCTGAAAAGCCTCA CCTGAACCTGTGGCTGGAAGCCCCCGACCTCCTCTTGGCCGAAATTGACCTCCCCAAACT GGATGGAGCCCTGGGGCTGTCGCTGGAGATCGGGGAGAACCGCCTGGTGATGGGGGGCCC CCAGCAGCTGTATCATCTAGACGCTTATATCCCGCTGCAGATCAACTCTCATGAGAGCAA GGCAGCCTTCCACCGGAAGAGAAAGCAATTAATGGTGGCCATGCCGCTTCTGCTGGTGCC TTCTTGATCAGGGTGTCTCCTTGTGCTTCTGAGATGTGGAGAAGAGGCTGCTGGCTTCCC TAAAAGTTGAAATAAAAGATTTTTGCCTTTAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_017916 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_017916.1, NP_060386.1 |
RefSeq Size | 1208 bp |
RefSeq ORF | 873 bp |
Locus ID | 55011 |
UniProt ID | Q9NWS0 |
Protein Families | Druggable Genome |
Gene Summary | Involved in the assembly of C/D box small nucleolar ribonucleoprotein (snoRNP) particles (PubMed:17636026). Recruits the SWI/SNF complex to the core promoter of rRNA genes and enhances pre-rRNA transcription (PubMed:22368283, PubMed:24036451). Mediates interaction of TELO2 with the R2TP complex which is necessary for the stability of MTOR and SMG1 (PubMed:20864032). Positively regulates the assembly and activity of the mTORC1 complex (PubMed:24036451).[UniProtKB/Swiss-Prot Function] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
A novel interaction of ECD protein with R2TP complex component RUVBL1 is required for the functional role of ECD in cell cycle progression
,Mir, RA;Bele, A;Mirza, S;Srivastava, S;Olou, A;Ammons, SA;Kim, JH;Gurumurthy, CB;Qiu, F;Band, H;Band, V;,
Mol. Cell. Biol.
,PubMed ID 26711270
[PIH1D1]
|
Mechanism of the AAA+ ATPases pontin and reptin in the biogenesis of H/ACA RNPs
,Rosario Machado-Pinilla, Dominique Liger, Nicolas Leulliot, and U. Thomas Meier,
RNA, Oct 2012; 18: 1833 - 1845.
[PIH1D1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200158 | PIH1D1 (Myc-DDK-tagged)-Human PIH1 domain containing 1 (PIH1D1) |
CNY 2400.00 |
|
RC200158L3 | Lenti ORF clone of Human PIH1 domain containing 1 (PIH1D1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC200158L4 | Lenti ORF clone of Human PIH1 domain containing 1 (PIH1D1), mGFP tagged |
CNY 5890.00 |
|
RG200158 | PIH1D1 (tGFP-tagged) - Human PIH1 domain containing 1 (PIH1D1) |
CNY 4370.00 |