Cathepsin L (CTSL) (NM_001912) Human Untagged Clone
CAT#: SC321091
CTSL1 (untagged)-Human cathepsin L1 (CTSL1), transcript variant 1
CNY 3656.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CATL; CTSL1; MEP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001912.3
GGGGGGCCGGACAGGGACTGGAAGAGAGGACGCGGTCGAGTAGGTGTGCACCAGCCCTGG
CAACGAGAGCGTCTACCCCGAACTCTGCTGGCCTTGAGGTGGGGAAGCCGGGGAGGGCAG TTGAGGACCCCGCGGAGGCGCGTGACTGGTTGAGCGGGCAGGCCAGCCTCCGAGCCGGGT GGACACAGGTTTTAAAACATGAATCCTACACTCATCCTTGCTGCCTTTTGCCTGGGAATT GCCTCAGCTACTCTAACATTTGATCACAGTTTAGAGGCACAGTGGACCAAGTGGAAGGCG ATGCACAACAGATTATACGGCATGAATGAAGAAGGATGGAGGAGAGCAGTGTGGGAGAAG AACGTGAAGATGATTGAACTGCACAATCAGGAATACAGGGAAGGGAAACACAGCTTCACA ATGGCCATGAACGCCTTTGGAGACATGACCAGTGAAGAATTCAGGCAGGTGATGAATGGC TTTCAAAACCGTAAGCCCAGGAAGGGGAAAGTGTTCCAGGAACCTCTGTTTTATGAGGCC CCCAGATCTGTGGATTGGAGAGAGAAAGGCTACGTGACTCCTGTGAAGAATCAGGGTCAG TGTGGTTCTTGTTGGGCTTTTAGTGCTACTGGTGCTCTTGAAGGACAGATGTTCCGGAAA ACTGGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGC AATGAAGGCTGCAATGGTGGCCTAATGGATTATGCTTTCCAGTATGTTCAGGATAATGGA GGCCTGGACTCTGAGGAATCCTATCCATATGAGGCAACAGAAGAATCCTGTAAGTACAAT CCCAAGTATTCTGTTGCTAATGACACCGGCTTTGTGGACATCCCTAAGCAGGAGAAGGCC CTGATGAAGGCAGTTGCAACTGTGGGGCCCATTTCTGTTGCTATTGATGCAGGTCATGAG TCCTTCCTGTTCTATAAAGAAGGCATTTATTTTGAGCCAGACTGTAGCAGTGAAGACATG GATCATGGTGTGCTGGTGGTTGGCTACGGATTTGAAAGCACAGAATCAGATAACAATAAA TATTGGCTGGTGAAGAACAGCTGGGGTGAAGAATGGGGCATGGGTGGCTACGTAAAGATG GCCAAAGACCGGAGAAACCATTGTGGAATTGCCTCAGCAGCCAGCTACCCCACTGTGTGA GCTGGTGGACGGTGATGAGGAAGGACTTGACTGGGGATGGCGCATGCATGGGAGGAATTC ATCTTCAGTCTACCAGCCCCCGCTGTGTCGGATACACACTCGAATCATTGAAGATCCGAG TGTGATTTGAATTCTGTGATATTTTCACACTGGTAAATGTTACCTCTATTTTAATTACTG CTATAAATAGGTTTATATTATTGATTCACTTACTGACTTTGCATTTTCGTTTTTAAAAGG ATGTATAAATTTTTACCTGTTTAAATAAAATTTAATTTCAAAAAAAGAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001912 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001912.3, NP_001903.1 |
| RefSeq Size | 1731 bp |
| RefSeq ORF | 1002 bp |
| Locus ID | 1514 |
| UniProt ID | P07711 |
| Domains | Pept_C1 |
| Protein Families | Druggable Genome, Protease |
| Protein Pathways | Antigen processing and presentation, Lysosome |
| Gene Summary | The protein encoded by this gene is a lysosomal cysteine proteinase that plays a major role in intracellular protein catabolism. Its substrates include collagen and elastin, as well as alpha-1 protease inhibitor, a major controlling element of neutrophil elastase activity. The encoded protein has been implicated in several pathologic processes, including myofibril necrosis in myopathies and in myocardial ischemia, and in the renal tubular response to proteinuria. This protein, which is a member of the peptidase C1 family, is a dimer composed of disulfide-linked heavy and light chains, both produced from a single protein precursor. Additionally, this protein cleaves the S1 subunit of the SARS-CoV-2 spike protein, which is necessary for entry of the virus into the cell. [provided by RefSeq, Aug 2020] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-4 encode the same isoform (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
a5ß1-Integrin controls ebolavirus entry by regulating endosomal cathepsins
,Kathryn L. Schornberg, Charles J. Shoemaker, Derek Dube, Michelle Y. Abshire, Sue E. Delos, Amy H. Bouton, and Judith M. White,
PNAS, May 2009; 106: 8003 - 8008.
[CTSL]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203143 | CTSL1 (Myc-DDK-tagged)-Human cathepsin L1 (CTSL1), transcript variant 1 |
CNY 2400.00 |
|
| RC203143L1 | Lenti ORF clone of Human cathepsin L1 (CTSL1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC203143L2 | Lenti ORF clone of Human cathepsin L1 (CTSL1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC203143L3 | Lenti ORF clone of Human cathepsin L1 (CTSL1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203143L4 | Lenti ORF clone of Human cathepsin L1 (CTSL1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG203143 | CTSL1 (tGFP-tagged) - Human cathepsin L1 (CTSL1), transcript variant 1 |
CNY 4000.00 |
|
| SC124186 | CTSL1 (untagged)-Human cathepsin L1 (CTSL1), transcript variant 1 |
CNY 3656.00 |
其它Cathepsin L产品
