PABP2 (PABPN1) (NM_004643) Human Untagged Clone
CAT#: SC321087
PABPN1 (untagged)-Human poly(A) binding protein, nuclear 1 (PABPN1)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | OPMD; PAB2; PABII; PABP-2; PABP2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004643.1
GGGGGGCGATGGCGGCGGCGGCGGCGGCGGCAGCAGCAGCGGGGGCTGCGGGCGGTCGGG
GCTCCGGGCCGGGGCGGCGGCGCCATCTTGTGCCCGGGGCCGGTGGGGAGGCCGGGGAGG GGGCCCCGGGGGGCGCAGGGGACTACGGGAACGGCCTGGAGTCTGAGGAACTGGAGCCTG AGGAGCTGCTGCTGGAGCCCGAGCCGGAGCCCGAGCCCGAAGAGGAGCCGCCCCGGCCCC GCGCCCCCCCGGGAGCTCCGGGCCCTGGGCCTGGTTCGGGAGCCCCCGGCAGCCAAGAGG AGGAGGAGGAGCCGGGACTGGTCGAGGGTGACCCGGGGGACGGCGCCATTGAGGACCCGG AGCTGGAAGCTATCAAAGCTCGAGTCAGGGAGATGGAGGAAGAAGCTGAGAAGCTAAAGG AGCTACAGAACGAGGTAGAGAAGCAGATGAATATGAGTCCACCTCCAGGCAATGCTGGCC CGGTGATCATGTCCATTGAGGAGAAGATGGAGGCTGATGCCCGTTCCATCTATGTTGGCA ATGTGGACTATGGTGCAACAGCAGAAGAGCTGGAAGCTCACTTTCATGGCTGTGGTTCAG TCAACCGTGTTACCATACTGTGTGACAAATTTAGTGGCCATCCCAAAGGGTTTGCGTATA TAGAGTTCTCAGACAAAGAGTCAGTGAGGACTTCCTTGGCCTTAGATGAGTCCCTATTTA GAGGAAGGCAAATCAAGGTGATCCCAAAACGAACCAACAGACCAGGCATCAGCACAACAG ACCGGGGTTTTCCACGAGCCCGCTACCGCGCCCGGACCACCAACTACAACAGCTCCCGCT CTCGATTCTACAGTGGTTTTAACAGCAGGCCCCGGGGTCGCGTCTACAGGGGCCGGGCTA GAGCGACATCATGGTATTCCCCTTACTAAAAAAAGTGTGTATTAGGAGGAGAGAGAGGAA AAAAAGAGGAAAGAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004643 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004643.1, NP_004634.1 |
| RefSeq Size | 3107 bp |
| RefSeq ORF | 921 bp |
| Locus ID | 8106 |
| UniProt ID | Q86U42 |
| Domains | RRM |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes an abundant nuclear protein that binds with high affinity to nascent poly(A) tails. The protein is required for progressive and efficient polymerization of poly(A) tails at the 3' ends of eukaryotic transcripts and controls the size of the poly(A) tail to about 250 nt. At steady-state, this protein is localized in the nucleus whereas a different poly(A) binding protein is localized in the cytoplasm. This gene contains a GCG trinucleotide repeat at the 5' end of the coding region, and expansion of this repeat from the normal 6 copies to 8-13 copies leads to autosomal dominant oculopharyngeal muscular dystrophy (OPMD) disease. Related pseudogenes have been identified on chromosomes 19 and X. Read-through transcription also exists between this gene and the neighboring upstream BCL2-like 2 (BCL2L2) gene. [provided by RefSeq, Dec 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203118 | PABPN1 (Myc-DDK-tagged)-Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 3600.00 |
|
| RC203118L1 | Lenti-ORF clone of PABPN1 (Myc-DDK-tagged)-Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 6000.00 |
|
| RC203118L2 | Lenti-ORF clone of PABPN1 (mGFP-tagged)-Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 5890.00 |
|
| RC203118L3 | Lenti-ORF clone of PABPN1 (Myc-DDK-tagged)-Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 5890.00 |
|
| RC203118L4 | Lenti-ORF clone of PABPN1 (mGFP-tagged)-Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 6000.00 |
|
| RG203118 | PABPN1 (tGFP-tagged) - Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 5200.00 |
|
| SC117245 | PABPN1 (untagged)-Human poly(A) binding protein, nuclear 1 (PABPN1) |
CNY 3600.00 |
