SEP15 (NM_203341) Human Untagged Clone
CAT#: SC321079
41532 (untagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3696.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Synonyms | SEP15 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_203341.1
GGGGAGGCAGCCAGAAACCTGCGGAAAATGGTAGCGATGGCGGCTGGGCCGAGTGGGTGT
CTGGTGCCGGCGTTTGGGCTACGGTTGTTGTTGGCGACTGTGCTTCAAGCGGTGTCTGCT TTTGGGGCAGAGTTTTCATCGGAGGCATGCAGAGAGTTAGGCTTTTCTAGCAACTTGCTT TGCAGCTCTTGTGATCTTCTCGGACAGTTCAACCTGCTTCAGCTGGATCCTGATTGCAGA GGATGCTGTCAGGAGGAAGCACAATTTGAAACCAAAAAGCTGTATGCAGGAGCTATTCTT GAAGTTTGTGGATGAAAATTGGGAAGGTTCCCTCAAGTCCAAGTATGTCCGTGGTTCAGA CCCTGTATTAAAGCTTTTGGACGACAATGGGAACATTGCTGAAGAACTGAGCATTCTCAA ATGGAACACAGACAGTGTAGAAGAATTCCTGAGTGAAAAGTTGGAACGCATATAAATCTT GCTTAAATTTTGTCCTATCCTTTTGTTACCTTATCAAATGAAATATTACAGCACCTAGAA AATAATTTAGTTTTGCTTGCTTCCATTGATCAGTCTTTTACTTGAGGCATTAAATATCTA ATTAAATCGTGAAATGGCAGTATAGTCCATGATATCTAAGGAGTTGGCAAGCTTAACAAA ACCCATTTTTTATAAATGTCCATCCTCCTGCATTTGTTGATACCACTAACAAAATGCTTT GTAACAGACTTGCGGTTAATTATGCAAATGATAGTTTGTGATAATTGGTCCAGTTTTACG AACAACAGATTTTTAAATTAGAGAGGTTAACAAGACAGATGATTACTATGCCTCATGTGC TGTGTGCTCTTTGAAAGGAATGACAGCAGACTACAAAGCAAATAAGATATACTGAGCCTC AACAGATTGCCTGCTCCTCAGAGTCTCTCCTATTTTTGTATTACCCAGCTTTCTTTTTAA TACAAATGTTATTTATAGTTTACAATGAATGCACTGCATAAAAACTTTGTAGCTTCATTA TTGTAAAACATATTCAAGATCCTACAGTAAGAGTGAAACATTCACAAAGATTTGCGTTAA TGAAGACTACACAGAAAACCTTTCTAAGGATTTGTGTGGATCAGATACATACTTGGCAAA TTTTTGAGTTTTACATTCTTACAGAAAAGTCCATTTAAAAGTGATCATTTGTAAGACCAA AATATAAATAAAAAGTTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_203341 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
| OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_203341.1, NP_976086.1 |
| RefSeq Size | 1801 bp |
| Locus ID | 9403 |
| UniProt ID | O60613 |
| Gene Summary | The protein encoded by this gene belongs to the SEP15/selenoprotein M family. The exact function of this protein is not known; however, it has been found to associate with UDP-glucose:glycoprotein glucosyltransferase (UGTR), an endoplasmic reticulum(ER)-resident protein, which is involved in the quality control of protein folding. The association with UGTR retains this protein in the ER, where it may play a role in protein folding. It has also been suggested to have a role in cancer etiology. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205084 | SEP15 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 1200.00 |
|
| RC205084L1 | Lenti-ORF, 41532 (Myc-DDK-tagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see summary) |
CNY 3600.00 |
|
| RG205084 | 41532 (GFP-tagged) - Human 15 kDa selenoprotein (SEP15), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2800.00 |
|
| SC308125 | 41532 (untagged)-Human 15 kDa selenoprotein (SEP15), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 3990.00 |
其它SEP15 (SEP15)产品
