ALG5 (NM_013338) Human Untagged Clone
CAT#: SC321071
ALG5 (untagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 1
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA421P11.2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_013338.3
GGGGGCCACGGCATGGAGAATGGCTCCGCTTCTGTTGCAGCTGGCGGTGCTCGGCGCGGC
GCTGGCGGCCGCAGCCCTCGTACTGATTTCCATCGTTGCATTTACAACTGCTACAAAAAT GCCAGCACTCCATCGACATGAAGAAGAGAAATTCTTCTTAAATGCCAAAGGCCAGAAAGA AACTTTACCCAGCATATGGGACTCACCTACCAAACAACTTTCTGTCGTTGTGCCTTCATA CAATGAAGAAAAACGGTTGCCTGTGATGATGGATGAAGCTCTGAGCTATCTAGAGAAGAG ACAGAAACGAGATCCTGCGTTCACTTATGAAGTGATAGTAGTTGATGATGGCAGTAAAGA TCAGACCTCAAAGGTAGCTTTTAAATATTGCCAGAAATATGGAAGTGACAAAGTACGTGT GATAACCCTGGTGAAGAATCGTGGAAAAGGTGGAGCGATTAGAATGGGTATATTCAGTTC TCGAGGAGAAAAGATCCTTATGGCAGATGCTGATGGAGCCACAAAGTTTCCAGATGTTGA GAAATTAGAAAAGGGGCTAAATGATCTACAGCCTTGGCCTAATCAAATGGCTATAGCATG TGGATCTCGAGCTCATTTAGAAAAAGAATCAATTGCTCAGCGTTCTTACTTCCGTACTCT TCTCATGTATGGGTTCCACTTTCTGGTGTGGTTCCTTTGTGTCAAAGGAATCAGGGACAC ACAGTGTGGGTTCAAATTATTTACTCGAGAAGCAGCTTCACGGACGTTTTCATCTCTACA CGTTGAACGATGGGCATTTGATGTAGAACTACTGTACATAGCACAGTTCTTTAAAATTCC AATAGCAGAAATTGCTGTCAACTGGACAGAAATTGAAGGTTCTAAATTAGTTCCATTCTG GAGCTGGCTACAAATGGGTAAAGACCTACTTTTTATACGACTTCGATATTTGACTGGTGC CTGGAGGCTTGAGCAAACTCGGAAAATGAATTAGGTTGTTTGCAGTCTTCAGTTGTGTTC TTATGCTTCAGTGTCACATTTCATTTCATTTGAAACTAAAATTTTAAGTAAAGCTGAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_013338 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013338.3, NP_037470.1 |
RefSeq Size | 1145 bp |
RefSeq ORF | 975 bp |
Locus ID | 29880 |
UniProt ID | Q9Y673 |
Domains | Glycos_transf_2 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, N-Glycan biosynthesis |
Gene Summary | This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203036 | ALG5 (Myc-DDK-tagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 1 |
CNY 2640.00 |
|
RC203036L3 | Lenti-ORF clone of ALG5 (Myc-DDK-tagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 1 |
CNY 5890.00 |
|
RC203036L4 | Lenti-ORF clone of ALG5 (mGFP-tagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 1 |
CNY 5890.00 |
|
RG203036 | ALG5 (tGFP-tagged) - Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 1 |
CNY 4370.00 |
|
SC115291 | ALG5 (untagged)-Human asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae) (ALG5), transcript variant 1 |
CNY 2400.00 |