SAP30 (NM_003864) Human Untagged Clone
CAT#: SC321068
SAP30 (untagged)-Human Sin3A-associated protein, 30kDa (SAP30)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003864.3
GGGGGACAGTGAGCGGGGTCCCCGCTCCAGGAGACGCTCGAGTCTGCGTCCCGGCCCTCA
GCACTGTCCACTGTTTCGGTGCCAGCAGAGACCAGCAGGCCCGGGACAGTTGGTGTTTGG CCGTGCCGCTGTCTAACTTGGTGTGCAGAGTGAATTGCCGCTGCCGGAGCGGAGAGAGGC GGAGCGGCCAGGAGAGAGGGGATTTCTGTCAGCGCCGGCCTCGGGAGCTCGGAGACATGA ACGGCTTCACGCCTGACGAGATGAGCCGCGGCGGGGATGCGGCCGCCGCAGTGGCCGCAG TGGTCGCTGCCGCGGCCGCCGCCGCCTCGGCGGGGAACGGGACCGGCGCGGGCACCGGGG CTGAGGTGCCGGGCGCGGGGGCGGTCTCAGCGGCTGGGCCCCCGGGGGCGGCCGGGCCGG GCCCCGGGCAACTGTGCTGCCTGCGGGAGGATGGTGAGCGGTGCGGCCGGGCGGCAGGCA ACGCCAGCTTCAGCAAGAGGATCCAGAAGAGCATCTCCCAGAAGAAGGTGAAGATCGAGC TGGATAAGAGCGCAAGGCATCTTTACATATGTGATTATCATAAAAACTTAATTCAGAGTG TTCGAAACAGAAGAAAGAGAAAAGGGAGTGATGATGATGGAGGTGATTCACCTGTTCAAG ATATTGATACCCCAGAGGTTGATTTATACCAATTACAAGTAAATACACTTAGGAGATACA AAAGACACTTCAAGCTACCAACCAGACCAGGACTTAATAAAGCACAACTTGTTGAGATAG TTGGTTGCCACTTTAGGTCTATTCCAGTGAATGAAAAAGACACCTTAACATATTTCATCT ACTCAGTGAAGAATGACAAGAACAAATCAGATCTCAAGGTTGATAGTGGTGTTCACTAGG AGACGTGGAATTGAGACTAATAACTTGGATGTTAACACTGTTTACTGTTTTTTCACATGT AGAAATGTTCTTTGTGTATTTTTTCTACAGAGGATTTTCTCTGATTTTATTTTCTTTGTT TCTGACTCTAATAATTAGTTGGAAACTCATATAAAATGAGCTTTCCTAAATTAAATCTAT TTTAAATAAAGGTTATTACTACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003864 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003864.3, NP_003855.1 |
RefSeq Size | 1126 bp |
RefSeq ORF | 663 bp |
Locus ID | 8819 |
UniProt ID | O75446 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Histone acetylation plays a key role in the regulation of eukaryotic gene expression. Histone acetylation and deacetylation are catalyzed by multisubunit complexes. The protein encoded by this gene is a component of the histone deacetylase complex, which includes SIN3, SAP18, HDAC1, HDAC2, RbAp46, RbAp48, and other polypeptides. This complex is active in deacetylating core histone octamers, but inactive in deacetylating nucleosomal histones. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203160 | SAP30 (Myc-DDK-tagged)-Human Sin3A-associated protein, 30kDa (SAP30) |
CNY 2400.00 |
|
RC203160L1 | Lenti ORF clone of Human Sin3A-associated protein, 30kDa (SAP30), Myc-DDK-tagged |
CNY 4800.00 |
|
RC203160L2 | Lenti ORF clone of Human Sin3A-associated protein, 30kDa (SAP30), mGFP tagged |
CNY 5890.00 |
|
RC203160L3 | Lenti ORF clone of Human Sin3A-associated protein, 30kDa (SAP30), Myc-DDK-tagged |
CNY 5890.00 |
|
RC203160L4 | Lenti ORF clone of Human Sin3A-associated protein, 30kDa (SAP30), mGFP tagged |
CNY 5890.00 |
|
RG203160 | SAP30 (tGFP-tagged) - Human Sin3A-associated protein, 30kDa (SAP30) |
CNY 4370.00 |
|
SC111087 | SAP30 (untagged)-Human Sin3A-associated protein, 30kDa (SAP30) |
CNY 2400.00 |