BAFF (TNFSF13B) (NM_006573) Human Untagged Clone
CAT#: SC320963
TNFSF13B (untagged)-Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1
CNY 2400.00
CNY 2950.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BAFF; BLYS; CD257; DTL; TALL-1; TALL1; THANK; TNFSF20; TNLG7A; ZTNF4 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_006573 edited
GAGGGGTAGAGATGCAGAAAGGCAGAAAGGAGAAAATTCAGGATAACTCTCCTGAGGGGT GAGCCAAGCCCTGCCATGTAGTGCACGCAGGACATCAACAAACACAGATAACAGGAAATG ATCCATTCCCTGTGGTCACTTATTCTAAAGGCCCCAACCTTCAAAGTTCAAGTAGTGATA TGGATGACTCCACAGAAAGGGAGCAGTCACGCCTTACTTCTTGCCTTAAGAAAAGAGAAG AAATGAAACTGAAGGAGTGTGTTTCCATCCTCCCACGGAAGGAAAGCCCCTCTGTCCGAT CCTCCAAAGACGGAAAGCTGCTGGCTGCAACCTTGCTGCTGGCACTGCTGTCTTGCTGCC TCACGGTGGTGTCTTTCTACCAGGTGGCCGCCCTGCAAGGGGACCTGGCCAGCCTCCGGG CAGAGCTGCAGGGCCACCACGCGGAGAAGCTGCCAGCAGGAGCAGGAGCCCCCAAGGCCG GCCTGGAGGAAGCTCCAGCTGTCACCGCGGGACTGAAAATCTTTGAACCACCAGCTCCAG GAGAAGGCAACTCCAGTCAGAACAGCAGAAATAAGCGTGCCGTTCAGGGTCCAGAAGAAA CAGTCACTCAAGACTGCTTGCAACTGATTGCAGACAGTGAAACACCAACTATACAAAAAG GATCTTACACATTTGTTCCATGGCTTCTCAGCTTTAAAAGGGGAAGTGCCCTAGAAGAAA AAGAGAATAAAATATTGGTCAAAGAAACTGGTTACTTTTTTATATATGGTCAGGTTTTAT ATACTGATAAGACCTACGCCATGGGACATCTAATTCAGAGGAAGAAGGTCCATGTCTTTG GGGATGAATTGAGTCTGGTGACTTTGTTTCGATGTATTCAAAATATGCCTGAAACACTAC CCAATAATTCCTGCTATTCAGCTGGCATTGCAAAACTGGAAGAAGGAGATGAACTCCAAC TTGCAATACCAAGAGAAAATGCACAAATATCACTGGATGGAGATGTCACATTTTTTGGTG CATTGAAACTGCTGTGACCTACTTACACCATGTCTGTAGCTATTTTCCTCCCTTTCTCTG TACCTCTAAGAAGAAAGAATCTAACAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006573 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006573.3, NP_006564.1 |
| RefSeq Size | 1204 bp |
| RefSeq ORF | 858 bp |
| Locus ID | 10673 |
| UniProt ID | Q9Y275 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (1) represents a longer transcript and encodes the longer protein isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204672 | TNFSF13B (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1 |
CNY 2400.00 |
|
| RC204672L1 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC204672L2 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC204672L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC204672L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
| RG204672 | TNFSF13B (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B), transcript variant 1 |
CNY 4000.00 |
