PIGP (NM_153682) Human Untagged Clone

CAT#: SC320893

PIGP (untagged)-Human phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), transcript variant 2



  "NM_153682" in other vectors (5)

CNY 1200.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PIGP Antibody - middle region
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DCRC; DCRC-S; DEE55; DSCR5; DSRC; EIEE55; PIG-P
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_153682.2 GGGGGCTCCCCAGTCGGCGCTTGCGCGGAGAACTCAGCGCTGAGATTGTCTAAAGCCCCA
GGAAAAATGGTGGAAAATTCACCGTCGCCATTGCCAGAAAGAGCGATTTATGGCTTTGTT
CTTTTCTTAAGCTCCCAATTTGGCTTCATACTTTACCTCGTGTGGGCCTTTATTCCTGAA
TCTTGGCTAAACTCTTTAGGTTTAACCTATTGGCCTCAAAAATATTGGGCAGTTGCATTA
CCTGTCTACCTCCTTATTGCTATAGTAATTGGCTACGTGCTCTTGTTTGGGATTAACATG
ATGAGTACCTCTCCACTCGACTCCATCCATACAATCACAGATAACTATGCAAAAAATCAA
CAGCAGAAGAAATACCAAGAGGAGGCCATTCCAGCCTTAAGAGATATTTCTATTAGTGAA
GTAAACCAAATGTTCTTTCTTGCAGCCAAAGAACTTTACACCAAAAACTGAACTGTGTGT
AACCATAGTAACACCAAGCACGTATTTATTTATAAGTTTTTGCCATTATAATTTTGACCA
TAAATTAATTTGACCATCTCTCTTATTAATAGAGAAGTAAAAAATGTAACTTGACCTTCT
CTTAGATTATGTTCAATGAATATTGTAAATGTTCAAGTATTGTTAATGAATAGAATAAAT
ACAATATTGCATTCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_153682
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_153682.2, NP_710149.1
RefSeq Size 804 bp
RefSeq ORF 405 bp
Locus ID 51227
UniProt ID P57054
Protein Families Transmembrane
Protein Pathways Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways
Gene Summary This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (2) contains a distinct 5' UTR and initiates translation from a downstream start codon, compared to variant 1. The encoded protein (isoform 2) has a shorter N-terminus compared to isoform 1. Variants 2 and 5 encode the same protein (isoform 2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...