TBC1D7 (NM_016495) Human Untagged Clone
CAT#: SC320756
TBC1D7 (untagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 1
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MGCPH; PIG51; TBC7 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_016495.2
GATGTCACGTCCGGCGGCGGCGGCAGCGGCAGCGGCAGCGGCGCTGAGTTTTGTCTCCCC
GGCCGTCTGGGCGCGCGCGGGTGTCCCAGAATGAAATATGACTGAGGACTCTCAGAGAAA CTTTCGTTCAGTATATTATGAGAAAGTGGGGTTTCGTGGAGTTGAAGAAAAGAAATCATT AGAAATTCTCCTAAAAGATGACCGTCTGGATACTGAGAAACTTTGTACTTTTAGTCAGAG GTTCCCTCTCCCGTCCATGTACCGTGCATTGGTATGGAAGGTGCTTCTAGGAATCTTGCC TCCACACCACGAGTCCCATGCCAAGGTGATGATGTATCGTAAGGAGCAGTACTTGGATGT CCTTCATGCCCTGAAAGTCGTTCGCTTTGTTAGTGATGCCACACCTCAGGCTGAAGTCTA TCTCCGCATGTATCAGCTGGAGTCTGGGAAGTTACCTCGAAGTCCCTCTTTTCCACTGGA GCCAGATGATGAAGTGTTTCTTGCCATAGCTAAAGCCATGGAGGAAATGGTGGAAGATAG TGTCGACTGTTACTGGATCACCCGACGCTTTGTGAACCAATTAAATACCAAGTACCGGGA TTCCTTGCCCCAGTTGCCAAAAGCGTTTGAACAATACTTGAATCTGGAAGATGGCAGACT GCTGACTCATCTGAGGATGTGTTCCGCGGCGCCCAAACTTCCTTATGATCTCTGGTTCAA GAGGTGCTTTGCGGGATGTTTGCCTGAATCCAGTTTACAGAGGGTTTGGGATAAAGTTGT GAGTGGATCCTGTAAGATCCTAGTTTTTGTAGCTGTCGAAATTTTATTAACCTTTAAAAT AAAAGTTATGGCACTGAACAGTGCAGAGAAGATAACAAAGTTTCTGGAAAATATTCCCCA GGACAGCTCAGACGCGATCGTGAGCAAGGCCATTGACTTGTGGCACAAACACTGTGGGAC CCCGGTCCATTCAAGCTGAACGCACCCGCTGGTTGTGGACCGTCTGCCAGGCACCACAGT GAGCATTGTGTTCTTGGCATGTGATCTGGGAAACTGATTGAATAATACACTTTTCTTGCT TTGGTGCTCAAAGTGGTTTTTTTCCCCCAATAAAATTATTTAATCGAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_016495 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_016495.2, NP_057579.1 |
| RefSeq Size | 1147 bp |
| RefSeq ORF | 882 bp |
| Locus ID | 51256 |
| UniProt ID | Q9P0N9 |
| Gene Summary | This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1, 2, 3, and 6 encode the same isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202792 | TBC1D7 (Myc-DDK-tagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 1 |
CNY 3990.00 |
|
| RC202792L3 | Lenti-ORF clone of TBC1D7 (Myc-DDK-tagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 1 |
CNY 5890.00 |
|
| RC202792L4 | Lenti-ORF clone of TBC1D7 (mGFP-tagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 1 |
CNY 5890.00 |
|
| RG202792 | TBC1D7 (tGFP-tagged) - Human TBC1 domain family, member 7 (TBC1D7), transcript variant 1 |
CNY 4370.00 |
|
| SC114250 | TBC1D7 (untagged)-Human TBC1 domain family, member 7 (TBC1D7), transcript variant 1 |
CNY 2400.00 |
