RBPMS (NM_001008712) Human Untagged Clone
CAT#: SC320655
RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3
CNY 2400.00
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HERMES |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001008712.1
CACTCAGCGGCTCTCGGGTCCCAGCGTCCCAGCCGCGGCCCGCGCTCCTCCGCCCCGCTC
CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCTCTAGGCACCCCCGTCCCCTCCTTCCAGCG GCTGCAGCCCCCAGCCCCAACTCTCCGCGCTTACTCCTGGGACGCGCGTCCTCGCCCCAT CCTTTGCTTCCTTCCTTCCTTCCTTCTTCCTTCCTCCCCTGGCTCCCGCCCTCCCTCTCC AGGTCGCCCTCCCGGGGCCCGATTGTCTCGGTGCCCCGCTCCCGGCCCGCGCCCTGCCCC GTCTCTCCCTTGCACTTCCTGAGTCGCCCGCCGCCGCCGTCGCAGACTCGCCGCGGGAGC CCCAGCCCAACCCGAGCCCGACAGCCACTGCCCCGGCTCCAGCTCCAGCCCCACAGCCCG CGGCGCCCGCCCGAGGGAGCCCCGGCGCCCGGGGAAGGCTCCAGTGGGCTAGCGCGCCCT CGCCCAGCCCCGCGCCCCAGCCCTGCCCGGCCCGGCGAGGAAGGACCGGGAAGATGAACA ACGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGG TCCGGACCCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGC TTTTCAGACCATTTAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTG TAGGTTTTGTCAGTTTTGACAGTCGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATG GCATCCGCTTCGATCCTGAAATTCCGCAAACACTACGACTAGAGTTTGCTAAGGCAAACA CGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAGTACTCCTCTGCCCAACA CTGTACCTCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTTTACCCCA GTAGCCCTGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTAC CTCCTCCTGCTTTCACCTATCCCGCTTCACTGCATGCCCAGTGTTTCTCTCCTGAGGCAA AGCCCAACACACCTGTCTTTTGTCCACTTCTCCAGCAAATTAGATTTGTCTCTGGGAATG TGTTTGTAACATACCAACCTACTGCAGACCAGCAGAGGGAGCTCCCATGTTGAATTTGTT TGTTAGCTATTTTCCCCCCTTTCACAAAAACTATTTCTTGACGACCTTTGAGAGATTTCA ATAAAAATTTTAATCAGAGCAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001008712 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001008712.1, NP_001008712.1 |
RefSeq Size | 1438 bp |
RefSeq ORF | 660 bp |
Locus ID | 11030 |
UniProt ID | Q93062 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (3) lacks several exons and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (C) has a longer and distinct C-terminus, compared to isoform A. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200248 | RBPMS (Myc-DDK-tagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3 |
CNY 2400.00 |
|
RC200248L3 | Lenti ORF clone of Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC200248L4 | Lenti ORF clone of Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG200248 | RBPMS (tGFP-tagged) - Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3 |
CNY 4000.00 |
|
SC301352 | RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 3 |
CNY 3990.00 |