DGCR6L (NM_033257) Human Untagged Clone
CAT#: SC320652
DGCR6L (untagged)-Human DiGeorge syndrome critical region gene 6-like (DGCR6L)
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DGCR6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_033257.2
GTGAAGCTGGGGGAGCTCGTCGCCGCCGCCGGCGGCTAGCGGGCGTCCGCGCCATGGAGC
GCTACGCGGCCGCCTTGGAGGAGGTGGCGGACGGTGCCCGGCAGCAGGAGCGACACTACC AGTTGCTGTCGGCGCTACAGAGCCTGGTGAAGGAGTTGCCCAGCTCTTTCCAGCAGCGCC TGTCCTACACCACGCTCAGCGACCTGGCCCTGGCGCTTCTCGACGGCACCGTGTTCGAAA TCGTGCAGGGGCTACTGGAGATCCAGCACCTCACCGAAAAGAGCCTGTACAACCAGCGCC TGCGCCTACAGAACGAGCACCGAGTGCTCAGGCAGGCGCTGCGGCAGAAGCACCAGGAAG CCCAGCAGGCCTGCCGGCCCCACAACCTGCCTGTGGTTCAGGCGGCTCAGCAGCGAGAAC TAGAGGCCGTGGAACACCGGATCCGTGAGGAGCAGCGGGCGATGGACCAGAAGATCATCC TGGAGCTGGACCGGAAGGTGGCTGACCAGCAGAGCACACTGGAGAAGGCGGGGGTGGCTG GCTTCTACGTGACCACCAACCCACAGGAGCTGATGCTGCAGATGAACCTGCTGGAACTCA TCCGAAAGCTGCAGCAGAGGGGCTGCCGGGCAGGGAATGCAGCCCTGGGACTGGGAGGTC CCTGGCAGTCGCCTGCTGCCCAGTGTGACCAGAAAGGCAGCCCTGTCCCACCATAGCCAC AGGCAGCAGAAGTCTGGGCAGAGTTCATCTTCTTGACCTTTGGCCACTGCCTTCCCAGCT GCCCGCAGGGGGTTCCCCCTGCTGAGGAGAGACCAGGTGGACCCCAGCTGCCTGTCACCC TTCATCTGGGACTTGCTGTCAAACCCTAGGATAGTCTCATAAAGGGGAGGCTGGGCCAGC CTGCTGCTGTCTGCTTCAGGACCAGGCAGAGAGTGAGGCTGGGGGTTCTCACACCTTACT CCACCGGGCACATCCCAACCTGCACTGGGGCCCACCCGAGCGCTTGTTCTGGTCTCAGCC GCTCCCTTGGCAGCTGCAGCCCCCATGCAGAAGAGGCTCCCAGGCCCAAGCTCTGTGTGA CCCAGAGAAATAAAGATGCCTCAGTGTGGCCCAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_033257 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033257.2, NP_150282.1 |
RefSeq Size | 1182 bp |
RefSeq ORF | 663 bp |
Locus ID | 85359 |
UniProt ID | Q9BY27 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene, the result of a duplication at this locus, is one of two functional genes encoding nearly identical proteins that have similar expression patterns. The product of this gene is a protein that shares homology with the Drosophila gonadal protein, expressed in gonadal tissues and germ cells, and with the human laminin gamma-1 chain that functions in cell attachment and migration. This gene is located in a region of chromosome 22 implicated in the DiGeorge syndrome, one facet of a broader collection of anomalies referred to as the CATCH 22 syndrome. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200317 | DGCR6L (Myc-DDK-tagged)-Human DiGeorge syndrome critical region gene 6-like (DGCR6L) |
CNY 2400.00 |
|
RC200317L1 | Lenti ORF clone of Human DiGeorge syndrome critical region gene 6-like (DGCR6L), Myc-DDK-tagged |
CNY 4800.00 |
|
RC200317L2 | Lenti ORF clone of Human DiGeorge syndrome critical region gene 6-like (DGCR6L), mGFP tagged |
CNY 5890.00 |
|
RC200317L3 | Lenti ORF clone of Human DiGeorge syndrome critical region gene 6-like (DGCR6L), Myc-DDK-tagged |
CNY 5890.00 |
|
RC200317L4 | Lenti ORF clone of Human DiGeorge syndrome critical region gene 6-like (DGCR6L), mGFP tagged |
CNY 5890.00 |
|
RG200317 | DGCR6L (tGFP-tagged) - Human DiGeorge syndrome critical region gene 6-like (DGCR6L) |
CNY 4000.00 |
|
SC126909 | DGCR6L (untagged)-Human DiGeorge syndrome critical region gene 6-like (DGCR6L) |
CNY 2400.00 |