GDAP1L1 (NM_024034) Human Untagged Clone
CAT#: SC320647
GDAP1L1 (untagged)-Human ganglioside-induced differentiation-associated protein 1-like 1 (GDAP1L1)
CNY 3656.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dJ881L22.1; dJ995J12.1.1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_024034.3
GAGAGCCGCCGCGCCGGAGCCTCCTTCTTTCCTGCCTCTGATTCCGGGCTGTCATGGCGA
CCCCCAACAATCTGACCCCCACCAACTGCAGCTGGTGGCCCATCTCCGCGCTGGAGAGCG ATGCGGCCAAGCCAGCGGAGGCCCCCGACGCTCCCGAGGCGGCCAGCCCCGCCCATTGGC CCAGGGAGAGCCTGGTTCTGTACCACTGGACCCAGTCCTTCAGCTCGCAGAAGGTGCGGC TGGTGATCGCCGAGAAGGGCCTGGTGTGCGAGGAGCGGGACGTGAGCCTGCCACAGAGCG AGCACAAGGAGCCCTGGTTCATGCGGCTCAACCTGGGCGAGGAGGTGCCCGTCATCATCC ACCGCGACAACATCATCAGTGACTATGACCAGATCATTGACTATGTGGAGCGCACCTTCA CAGGAGAGCACGTGGTGGCCCTGATGCCCGAGGTGGGCAGCCTGCAGCACGCACGGGTGC TGCAGTACCGGGAGCTGCTGGACGCACTGCCCATGGATGCCTACACGCATGGCTGCATCC TGCATCCCGAGCTCACCACCGACTCCATGATCCCCAAGTACGCCACGGCCGAGATCCGCA GACATTTAGCCAATGCCACCACGGACCTCATGAAACTGGACCATGAAGAGGAGCCCCAGC TCTCCGAGCCCTACCTTTCTAAACAAAAGAAGCTCATGGCCAAGATCTTGGAGCATGATG ATGTGAGCTACCTGAAGAAGATCCTCGGGGAACTGGCCATGGTGCTGGACCAGATTGAGG CGGAGCTGGAGAAGAGGAAGCTGGAGAACGAGGGGCAGAAATGCGAGCTGTGGCTCTGTG GCTGTGCCTTCACCCTCGCTGATGTCCTCCTGGGAGCCACCCTGCACCGCCTCAAGTTCC TGGGACTGTCCAAGAAATACTGGGAAGATGGCAGCCGGCCCAACCTGCAGTCCTTCTTTG AGAGGGTCCAGAGACGCTTTGCCTTCCGGAAAGTCCTGGGTGACATCCACACCACCCTGC TGTCGGCCGTCATCCCCAATGCTTTCCGGCTGGTCAAGAGGAAACCCCCATCCTTCTTCG GGGCGTCCTTCCTCATGGGCTCCCTGGGTGGGATGGGCTACTTTGCCTACTGGTACCTCA AGAAAAAATACATCTAGGGCCAGGCCTGGGGCTTGGTGTCTGAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_024034 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_024034.3, NP_076939.3 |
| RefSeq Size | 2244 bp |
| RefSeq ORF | 1104 bp |
| Locus ID | 78997 |
| UniProt ID | Q96MZ0 |
| Protein Families | Transmembrane |
| Gene Summary | The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200976 | GDAP1L1 (Myc-DDK-tagged)-Human ganglioside-induced differentiation-associated protein 1-like 1 (GDAP1L1) |
CNY 3656.00 |
|
| RC200976L3 | Lenti ORF clone of Human ganglioside-induced differentiation-associated protein 1-like 1 (GDAP1L1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC200976L4 | Lenti ORF clone of Human ganglioside-induced differentiation-associated protein 1-like 1 (GDAP1L1), mGFP tagged |
CNY 5890.00 |
|
| RG200976 | GDAP1L1 (tGFP-tagged) - Human ganglioside-induced differentiation-associated protein 1-like 1 (GDAP1L1) |
CNY 4370.00 |
|
| SC112289 | GDAP1L1 (untagged)-Human ganglioside-induced differentiation-associated protein 1-like 1 (GDAP1L1) |
CNY 3656.00 |
其它GDAP1L1产品
