PIG3 (TP53I3) (NM_004881) Human Untagged Clone
CAT#: SC320582
TP53I3 (untagged)-Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 1
CNY 2400.00
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PIG3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004881.2
AGGAGCCAGAACCACTCGGCGCCGCCTGGTGCATGGGAGGGGAGCCGGGCCAGGAACAAT
ATGTTAGCCGTGCACTTTGACAAGCCGGGAGGACCGGAAAACCTCTACGTGAAGGAGGTG GCCAAGCCGAGCCCGGGGGAGGGTGAAGTCCTCCTGAAGGTGGCGGCCAGCGCCCTGAAC CGGGCGGACTTAATGCAGAGACAAGGCCAGTATGACCCACCTCCAGGAGCCAGCAACATT TTGGGACTTGAGGCATCTGGACATGTGGCAGAGCTGGGGCCTGGCTGCCAGGGACACTGG AAGATCGGGGACACAGCCATGGCTCTGCTCCCCGGTGGGGGCCAGGCTCAGTACGTCACT GTCCCCGAAGGGCTCCTCATGCCTATCCCAGAGGGATTGACCCTGACCCAGGCTGCAGCC ATCCCAGAGGCCTGGCTCACCGCCTTCCAGCTGTTACATCTTGTGGGAAATGTTCAGGCT GGAGACTATGTGCTAATCCATGCAGGACTGAGTGGTGTGGGCACAGCTGCTATCCAACTC ACCCGGATGGCTGGAGCTATTCCTCTGGTCACAGCTGGCTCCCAGAAGAAGCTTCAAATG GCAGAAAAGCTTGGAGCAGCTGCTGGATTCAATTACAAAAAAGAGGATTTCTCTGAAGCA ACGCTGAAATTCACCAAAGGTGCTGGAGTTAATCTTATTCTAGACTGCATAGGCGGATCC TACTGGGAGAAGAACGTCAACTGCCTGGCTCTTGATGGTCGATGGGTTCTCTATGGTCTG ATGGGAGGAGGTGACATCAATGGGCCCCTGTTTTCAAAGCTACTTTTTAAGCGAGGAAGT CTGATCACCAGTTTGCTGAGGTCTAGGGACAATAAGTACAAGCAAATGCTGGTGAATGCT TTCACGGAGCAAATTCTGCCTCACTTCTCCACGGAGGGCCCCCAACGTCTGCTGCCGGTT CTGGACAGAATCTACCCAGTGACCGAAATCCAGGAGGCCCATAAGTACATGGAGGCCAAC AAGAACATAGGCAAGATCGTCCTGGAACTGCCCCAGTGAAGGAGGATGGGGCAGGACAGG ACGCGGCCACCCCAGGCCTTTCCAGAGCAAACCTGGAGAAGATTCACAATAGACAGGCCA AGAAACCCGGTGCTTCCTCCAGAGCCGTTTAAAGCTGATATGAGGAAATAAAGAGTGAAC TGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004881 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004881.2, NP_004872.2 |
RefSeq Size | 1675 bp |
RefSeq ORF | 999 bp |
Locus ID | 9540 |
UniProt ID | Q53FA7 |
Domains | ADH_zinc_N |
Protein Families | Druggable Genome |
Protein Pathways | p53 signaling pathway |
Gene Summary | The protein encoded by this gene is similar to oxidoreductases, which are enzymes involved in cellular responses to oxidative stresses and irradiation. This gene is induced by the tumor suppressor p53 and is thought to be involved in p53-mediated cell death. It contains a p53 consensus binding site in its promoter region and a downstream pentanucleotide microsatellite sequence. P53 has been shown to transcriptionally activate this gene by interacting with the downstream pentanucleotide microsatellite sequence. The microsatellite is polymorphic, with a varying number of pentanucleotide repeats directly correlated with the extent of transcriptional activation by p53. It has been suggested that the microsatellite polymorphism may be associated with differential susceptibility to cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011] Transcript Variant: This variant (1) and variant 2 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201839 | TP53I3 (Myc-DDK-tagged)-Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 1 |
CNY 2400.00 |
|
RC201839L3 | Lenti ORF clone of Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC201839L4 | Lenti ORF clone of Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG201839 | TP53I3 (tGFP-tagged) - Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 1 |
CNY 4000.00 |
|
SC110067 | TP53I3 (untagged)-Human tumor protein p53 inducible protein 3 (TP53I3), transcript variant 1 |
CNY 2400.00 |