ITGB3BP (NM_014288) Human Untagged Clone

CAT#: SC320275

ITGB3BP (untagged)-Human integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), transcript variant 2



  "NM_014288" in other vectors (6)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
ITGB3BP mouse monoclonal antibody, clone OTI4H1 (formerly 4H1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CENP-R; CENPR; HSU37139; NRIF3; TAP20
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_014288.3 CTGGGTTCGTTTTATTCAGCGGCAGTGGTGCTTTCCCGAATCTCAGAATGCCTGTTAAAA
GATCACTGAAGTTGGATGGTCTGTTAGAAGAAAATTCATTTGATCCTTCAAAAATCACAA
GGAAGAAAAGTGTTATAACTTATTCTCCAACAACTGGAACTTGTCAAATGAGTCTATTTG
CTTCTCCCACAAGTTCTGAAGAGCAAAAGCACAGAAATGGACTATCAAATGAAAAGAGAA
AAAAATTGAATCACCCCAGTTTAACTGAAAGCAAAGAATCTACAACAAAAGACAATGATG
AATTCATGATGTTGCTATCAAAAGTTGAGAAATTGTCAGAAGAAATCATGGAGATAATGC
AAAATTTAAGTAGTATACAGGCTTTGGAGGGCAGTAGAGAGCTTGAAAATCTCATTGGAA
TCTCCTGTGCATCACATTTCTTAAAAAGAGAAATGCAGAAAACCAAAGAACTAATGACAA
AAGTGAATAAACAAAAACTGTTTGAAAAGAGTACAGGACTTCCTCACAAAGCATCACGTC
ATCTTGACAGCTATGAATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCA
CTCACCATGAGCACCAACTTCTGCATCTGCCTGATCATATTTAAAGGAACAGAGAAATAT
TTGTAATTAATCTGCCCAGTAAATACCAGCTCGTAGCAGTTGGCAGGTGCATGTCTAGAT
AAAATTTCTTGCAGCTAATTTAAACTTTCTACACGCACCAGTAGATAATCTCAATGTAAA
TAATACATTTCTTCTTGGCTCTTTAATGTAAGCCAACATGGAGAGGAAGATCTTGACTTA
TATTCTGTACCACATACACTTCTGTGGACTTTTAGCATTTGTGGGTAGACTTAATAAAGC
ATGTATAAAAGTGAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_014288
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_014288.3, NP_055103.3
RefSeq Size 892 bp
RefSeq ORF 534 bp
Locus ID 23421
UniProt ID Q13352
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Gene Summary This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. Isoform 2 is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...