PPT2 (NM_005155) Human Untagged Clone
CAT#: SC320220
PPT2 (untagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf8; G14; PPT-2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_005155, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGGCTCTGCGGGCAGCGGCTCCCCGCGGCGTGGGTCCTGCTTCTGTTGCCTTTCCTGCCGCTGC TGCTGCTTGCAGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCGTGGTGCATGGGCTCTTCGA CAGCTCGTACAGCTTCCGCCACCTGCTGGAATACATCAATGAGACACACCCCGGGACTGTGGTGACAGTG CTCGATCTCTTCGATGGGAGAGAGAGCTTGCGACCCCTGTGGGAACAGGTGCAAGGGTTCCGAGAGGCTG TGGTCCCCATCATGGCAAAGGCCCCTCAAGGGGTGCATCTCATCTGCTACTCGCAGGGGGGCCTTGTGTG CCGGGCTCTGCTTTCTGTCATGGATGATCACAACGTGGATTCTTTCATCTCCCTCTCCTCTCCACAGATG GGACAGTATGGAGACACGGACTACTTGAAGTGGCTGTTCCCCACCTCCATGCGGTCTAACCTCTATCGGA TCTGCTATAGCCCCTGGGGCCAGGAATTCTCCATCTGCAACTACTGGCATGATCCCCACCACGATGACTT GTACCTCAATGCCAGCAGCTTCCTGGCCCTGATCAATGGGGAAAGAGACCATCCCAATGCCACAGTATGG CGGAAGAACTTTCTGCGTGTGGGCCACCTGGTGCTGATTGGGGGCCCTGATGATGGTGTTATTACTCCCT GGCAGTCCAGCTTCTTTGGTTTCTATGATGCAAATGAGACCGTCCTGGAGATGGAGGAGCAACTGGTTTA TCTGCGGGATTCTTTTGGGTTGAAGACTCTATTGGCCCGGGGGGCCATAGTGAGGTGTCCAATGGCCGGT ATCTCCCACACAGCCTGGCACTCCAACCGTACCCTTTATGAGACCTGCATTGAACCTTGGCTCTCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_005155 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005155.5, NP_005146.3 |
RefSeq Size | 2202 bp |
RefSeq ORF | 909 bp |
Locus ID | 9374 |
UniProt ID | Q9UMR5 |
Protein Families | Transmembrane |
Protein Pathways | Fatty acid elongation in mitochondria, Lysosome, Metabolic pathways |
Gene Summary | This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the shorter isoform (a). Both variants 1 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200272 | PPT2 (Myc-DDK-tagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1 |
CNY 2400.00 |
|
RC200272L1 | Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC200272L2 | Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC200272L3 | Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC200272L4 | Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG200272 | PPT2 (tGFP-tagged) - Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1 |
CNY 4000.00 |