FKBP1B (NM_054033) Human Untagged Clone
CAT#: SC320205
FKBP1B (untagged)-Human FK506 binding protein 1B, 12.6 kDa (FKBP1B), transcript variant 2
CNY 1200.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FKBP1L; FKBP12.6; OTK4; PKBP1L; PPIase |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_054033.1
GCGAGCCGGAGCGACGGCGGGGCTGGGGCCGGAGCCGAGCCGGGGTCGGGCAGCAGCAGG
GACCCCCCAGAGGCGGGGCCTGTGGGACCGCTATGGGCGTGGAGATCGAGACCATCTCCC CCGGAGACGGAAGGACATTCCCCAAGAAGGGCCAAACGTGTGTGGTGCACTACACAGGAA TGCTCCAAAATGGGAAGAAGTTTGATTCATCCAGAGACAGAAACAAACCTTTCAAGTTCA GAATTGGCAAACAGGAAGTCATCAAAGGTTTTGAAGAGGGTGCAGCCCAGCTGGGTCCTC TTTCTCCTCTCCCCATCTGCCCCCATCCCTGCTAGATGAGCTTGGGGCAGAGGGCGAAGC TGACCTGCACCCCTGATGTGGCATATGGAGCCACGGGCCACCCCGGTGTCATCCCTCCCA ATGCCACCCTCATCTTTGACGTGGAGCTGCTCAACTTAGAGTGAAGGCAGGAAGGAACTC AAGGTGGCTGGAGATGGCTGCTGCTCACCCTCCTAGCCTGCTCTGCCACTGGGACGGCTC CTGCTTTTGGGGCTCTTGATCAGTGTGCTAACCTCACTGCCTCATGGCATCATCCATTCT CTCTGCCCAAGTTGCTCTGTATGTGTTCGTCAGTGTTCATGCGAATTCTTGCTTGAGGAA ACTTCGGTTGCAGATTGAAGCATTTCAGGTTGTGCATTTTGTGTGATGCATGTAGTAGCC TTTCCTGATGACAGAACACAGATCTCTTGTTCGCACAATCTACACTGCCTTACCTTCACT TAAACCACACACACAAGGTGCTCAGACATGAAATGTACATGGCGTACCGTACACAGAGGG ACTTGAGCCAGTTACCTTTGCTGTCACTTTCTCTCTTATAAATTCTGTTAGCTGCTCACT TAAACAATGTCCTCTTTGAGAAAATGTAAAATAAAGGCTCTGTGCTTGACAAAAAAAAAA AAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_054033 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_054033.1, NP_473374.1 |
RefSeq Size | 972 bp |
RefSeq ORF | 243 bp |
Locus ID | 2281 |
UniProt ID | P68106 |
Domains | FKBP |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is highly similar to the FK506-binding protein 1A. Its physiological role is thought to be in excitation-contraction coupling in cardiac muscle. There are two alternatively spliced transcript variants of this gene encoding different isoforms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200667 | FKBP1B (Myc-DDK-tagged)-Human FK506 binding protein 1B, 12.6 kDa (FKBP1B), transcript variant 2 |
CNY 1200.00 |
|
RC200667L3 | Lenti ORF clone of Human FK506 binding protein 1B, 12.6 kDa (FKBP1B), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC200667L4 | Lenti ORF clone of Human FK506 binding protein 1B, 12.6 kDa (FKBP1B), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG200667 | FKBP1B (tGFP-tagged) - Human FK506 binding protein 1B, 12.6 kDa (FKBP1B), transcript variant 2 |
CNY 2800.00 |