Osteopontin (SPP1) (NM_001040060) Human Untagged Clone
CAT#: SC320127
SPP1 (untagged)-Human secreted phosphoprotein 1 (SPP1), transcript variant 3
CNY 2400.00
CNY 6270.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BNSP; BSPI; ETA-1; OPN |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001040060.1
GTTGGTGGAGGATGTCTGCAGCAGCATTTAAATTCTGGGAGGGCTTGGTTGTCAGCAGCA
GCAGGAGGAGGCAGAGCACAGCATCGTCGGGACCAGACTCGTCTCAGGCCAGTTGCAGCC TTCTCAGCCAAACGCCGACCAAGGAAAACTCACTACCATGAGAATTGCAGTGATTTGCTT TTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAACAGGCTGATTCTGGAAGTTCTGA GGAAAAGCAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCC AAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGA CCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACTGA TGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACTGA TTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGACAC ATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTTCG CAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAAAG CGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTC TGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGC TGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAA TGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAG CCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGA TAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTA AAAGGAGAAAAAATACAATTTCTCACTTTGCATTTAGTCAAAAGAAAAAATGCTTTATAG CAAAATGAAAGAGAACATGAAATGCTTCTTTCTCAGTTTATTGGTTGAATGTGTATCTAT TTGAGTCTGGAAATAACTAATGTGTTTGATAATTAGTTTAGTTTGTGGCTTCATGGAAAC TCCCTGTAAACTAAAAGCTTCAGGGTTATGTCTATGTTCATTCTATAGAAGAAATGCAAA CTATCACTGTATTTTAATATTTGTTATTCTCTCATGAATAGAAATTTATGTAGAAGCAAA CAAAATACTTTTACCCACTTAAAAAGAGAATATAACATTTTATGTCACTATAATCTTTTG TTTTTTAAGTTAGTGTATATTTTGTTGTGATTATCTTTTTGTGGTGTGAATAAATCTTTT ATCTTGAATGTAATAAGAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001040060 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001040060.1, NP_001035149.1 |
| RefSeq Size | 1560 bp |
| RefSeq ORF | 864 bp |
| Locus ID | 6696 |
| UniProt ID | P10451 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | ECM-receptor interaction, Focal adhesion, Toll-like receptor signaling pathway |
| Gene Summary | The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 5. The resulting isoform (OPN-c, as described in PubMed: 7837791) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform e. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Lung cancer osteopontin isoforms exhibit angiogenic functional heterogeneity
,Justin D. Blasberg, Chandra M. Goparaju, Harvey I. Pass, and Jessica S. Donington,
J. Thorac. Cardiovasc. Surg., Jun 2010; 139: 1587 - 1593
[SPP1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210592 | SPP1 (Myc-DDK-tagged)-Human secreted phosphoprotein 1 (SPP1), transcript variant 3 |
CNY 2400.00 |
|
| RC210592L1 | Lenti ORF clone of Human secreted phosphoprotein 1 (SPP1), transcript variant 3, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC210592L2 | Lenti ORF clone of Human secreted phosphoprotein 1 (SPP1), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RC210592L3 | Lenti ORF clone of Human secreted phosphoprotein 1 (SPP1), transcript variant 3, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC210592L4 | Lenti ORF clone of Human secreted phosphoprotein 1 (SPP1), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG210592 | SPP1 (tGFP-tagged) - Human secreted phosphoprotein 1 (SPP1), transcript variant 3 |
CNY 4000.00 |
其它Osteopontin产品
