Alpha 1 microglobulin (AMBP) (NM_001633) Human Untagged Clone
CAT#: SC319944
AMBP (untagged)-Human alpha-1-microglobulin/bikunin precursor (AMBP)
CNY 3656.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | A1M; EDC1; HCP; HI30; IATIL; ITI; ITIL; ITILC; UTI |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001633.2
CCGGCCTCTTGGTACTGCTGACCCCAGCCAGGCTACAGGGATCGATTGGAGCTGTCCTTG
GGGCTGTAATTGGCCCCAGCTGAGCAGGGCAAACACTGAGGTCAACTACAAGCCACAGGC CCCTTCCCCAGCCTCAGTTCACAGCTGCCCTGTTGCAGGGAGGCGGTGGCCCTTCTGTTG CTAGACCGAGCCTGTGGGATATACCAAGGCAGAGGAGCCCATAGCCATGAGGAGCCTCGG GGCCCTGCTCTTGCTGCTGAGCGCCTGCCTGGCGGTGAGCGCTGGCCCTGTGCCAACGCC GCCCGACAACATCCAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTA CAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGT GAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCG TTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGG GAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACAC CAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCAC CATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTT CAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCG AGGTGAATGTGTCCCTGGGGAGCAGGAACCAGAGCCCATCTTAATCCCGAGAGTCCGGAG GGCTGTGCTACCCCAAGAAGAGGAAGGATCAGGGGGTGGGCAACTGGTAACTGAAGTCAC CAAGAAAGAAGATTCCTGCCAGCTGGGCTACTCGGCCGGTCCCTGCATGGGAATGACCAG CAGGTATTTCTATAATGGTACATCCATGGCCTGTGAGACTTTCCAGTACGGCGGCTGCAT GGGCAACGGTAACAACTTCGTCACAGAAAAGGAGTGTCTGCAGACCTGCCGAACTGTGGC GGCCTGCAATCTCCCCATAGTCCGGGGCCCCTGCCGAGCCTTCATCCAGCTCTGGGCATT TGATGCTGTCAAGGGGAAGTGCGTCCTCTTCCCCTACGGGGGCTGCCAGGGCAACGGGAA CAAGTTCTACTCAGAGAAGGAGTGCAGAGAGTACTGCGGTGTCCCTGGTGATGGTGATGA GGAGCTGCTGCGCTTCTCCAACTGACAACTGGCCGGTCTGCAAGTCAGAGGATGGCCAGT GTCTGTCCCGGGGTCCTGTGGCAGGCAGCGCCAAGCAACCTGGGTCCAAATAAAAACTAA ATTGTAAACTCCTGAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001633 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001633.2, NP_001624.1 |
| RefSeq Size | 1413 bp |
| RefSeq ORF | 1059 bp |
| Locus ID | 259 |
| UniProt ID | P02760 |
| Domains | lipocalin, KU |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Constitutive Expression of Inter-a-inhibitor (IaI) Family Proteins and Tumor Necrosis Factor-stimulated Gene-6 (TSG-6) by Human Amniotic Membrane Epithelial and Stromal Cells Supporting Formation of the Heavy Chain-Hyaluronan (HC-HA) Complex
,Suzhen Zhang, Hua He, Anthony J. Day, and Scheffer C. G. Tseng,
J. Biol. Chem., Apr 2012; 287: 12433 - 12444.
[AMBP]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208342 | AMBP (Myc-DDK-tagged)-Human alpha-1-microglobulin/bikunin precursor (AMBP) |
CNY 3656.00 |
|
| RC208342L1 | Lenti ORF clone of Human alpha-1-microglobulin/bikunin precursor (AMBP), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC208342L2 | Lenti ORF clone of Human alpha-1-microglobulin/bikunin precursor (AMBP), mGFP tagged |
CNY 5890.00 |
|
| RC208342L3 | Lenti ORF clone of Human alpha-1-microglobulin/bikunin precursor (AMBP), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC208342L4 | Lenti ORF clone of Human alpha-1-microglobulin/bikunin precursor (AMBP), mGFP tagged |
CNY 5890.00 |
|
| RG208342 | AMBP (tGFP-tagged) - Human alpha-1-microglobulin/bikunin precursor (AMBP) |
CNY 4370.00 |
其它Alpha 1 microglobulin产品
