TAX1BP3 (NM_014604) Human Untagged Clone
CAT#: SC319925
TAX1BP3 (untagged)-Human Tax1 (Human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TIP-1; TIP1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014604.2
GGGGACTCTGCTGCCGGCTTCTCGGAGCGGCGCTGGGCGACCAGAGCAGGGTCGAGATGT
CCTACATCCCGGGCCAGCCGGTCACCGCCGTGGTGCAAAGAGTTGAAATTCACAAGCTGC GTCAAGGTGAGAACTTAATCCTGGGTTTCAGCATTGGAGGTGGAATCGACCAGGACCCTT CCCAGAATCCCTTCTCTGAAGACAAGACGGACAAGGGTATTTATGTCACACGGGTGTCTG AAGGAGGCCCTGCTGAAATCGCTGGGCTGCAGATTGGAGACAAGATCATGCAGGTGAACG GCTGGGACATGACCATGGTCACACACGACCAGGCCCGCAAGCGGCTCACCAAGCGCTCGG AGGAGGTGGTGCGTCTGCTGGTGACGCGGCAGTCGCTGCAGAAGGCCGTGCAGCAGTCCA TGCTGTCCTAGCAGCCACCACCATCTGCGACTCCTGCCTGCCGCCTCTCTGTACAGTAAC GCCACTTCCACACTCTGTCCCCATCTGGCTTCTGCTGACCGCTGGGCCCCAGCTCAGAAG GGCTATAGCTGGTCCCAGAGGCCTGGCCTGGCCTTCCTTCCCTTCTCCCATCCCTGGCCT GGGGCCTCTGGGACCAGCTTTCTCTCCTGGACACCGAGGATTGGAAATAAGGGCCTGGAG CTGAGTAGTAGCCAGTCTGCTGTGACCACAGGCTCAGGTCCGACCCTGCTGCTTGGCCAC AGCAGTGGCTGGGCAAGTGGGAACCACTATCTCTTGGGAGCCCCCAAAAGCTGGGAAATG CTGGAGGAACCAGGCCTTTCCCGCTTTTGCCTGGCTGCAGGGTTCGGCTCCGCCCCTGCC CCCCAGCCCTCGTGTGTCCACATCGCAGTGCCTCTGCCCCTCGGGGGACTGGACACACAT CCTGCCAGAGGCGCTACGAAGCTTTGCCCAGATGAAGCCAGGTGGGCTCCGCGTTCACTC CCACTCTCCCGAGGGGTGCTGGCCTCCCCAGGGTTTGCCTTCTTACGGATTTAGACGAGG TTCGAGGCTCACCTATCAGGGCAGCTCTCAGGATTGTCATTTTCCTCTTTGCCTGTGGGT TTAACTTTTGTATTTTTTTAATCACAAGTTTGATACAAAATGTTTTTATCGTACTCTTTG GAGATGCCCATTCTACTTTTGAATTTAGCTTTTACTAATTCGCATCTGGAAGCTCAGCAA GTGCACAAGCCTTACTTTGGTTACCGTGGAAACCACTGCCGCCCCTCCCCGATGTGGTGC GCTCAATAAAAATGCTGGAATGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014604 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014604.2, NP_055419.1 |
RefSeq Size | 1421 bp |
RefSeq ORF | 375 bp |
Locus ID | 30851 |
UniProt ID | O14907 |
Domains | PDZ |
Gene Summary | This gene encodes a small, highly conserved protein with a single PDZ domain. PDZ (PSD-95/Discs large/ZO-1 homologous) domains promote protein-protein interactions that affect cell signaling, adhesion, protein scaffolding, and receptor and ion transporter functions. The encoded protein interacts with a large number of target proteins that play roles in signaling pathways; for example, it interacts with Rho A and glutaminase L and also acts as a negative regulator of the Wnt/beta-catenin signaling pathway. This protein was first identified as binding to the T-cell leukaemia virus (HTLV1) Tax oncoprotein. Overexpression of this gene has been implicated in altered cancer cell adhesion, migration and metastasis. The encoded protein also modulates the localization and density of inwardly rectifying potassium channel 2.3 (Kir2.3). To date, this protein has been shown to play a role in cell proliferation, development, stress response, and polarization. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204776 | TAX1BP3 (Myc-DDK-tagged)-Human Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1 |
CNY 1200.00 |
|
RC204776L1 | Lenti ORF clone of Human Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1, Myc-DDK-tagged |
CNY 3600.00 |
|
RC204776L2 | Lenti ORF clone of Human Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC204776L3 | Lenti ORF clone of Human Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC204776L4 | Lenti ORF clone of Human Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG204776 | TAX1BP3 (tGFP-tagged) - Human Tax1 (human T-cell leukemia virus type I) binding protein 3 (TAX1BP3), transcript variant 1 |
CNY 2800.00 |
其它TAX1BP3产品