GTF3C6 (NM_138408) Human Untagged Clone
CAT＃: SC319898
GTF3C6 (untagged)-Human general transcription factor IIIC, polypeptide 6, alpha 35kDa (GTF3C6)
CNY 2400.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bA397G5.3; C6orf51; TFIIIC35 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_138408.2
CCGGGCGGGCGTGGCCAGTGACTAGAAGGCGAGGCGCCGCGGGACCATGGCGGCGGCGGC
GGACGAGCGGAGTCCAGAGGACGGAGAAGACGAGGAAGAGGAGGAGCAGTTGGTTCTGGT GGAATTATCAGGAATTATTGATTCAGACTTCCTCTCAAAATGTGAAAATAAATGCAAGGT TTTGGGCATTGACACTGAGAGGCCCATTCTGCAAGTGGACAGCTGTGTCTTTGCTGGGGA GTATGAAGACACTCTAGGGACCTGTGTTATATTTGAAGAAAATGTTGAACATGCTGATAC AGAAGGCAATAATAAAACAGTGCTAAAATATAAATGCCATACAATGAAGAAGCTCAGCAT GACAAGAACTCTCCTGACAGAGAAGAAGGAAGGAGAAGAAAACATAGGTGGGGTGGAATG GCTGCAAATAAAGGATAATGATTTCTCCTATCGACCCAACATGATTTGTAACTTTCTACA TGAAAATGAAGACGAAGAAGTGGTAGCTTCAGCCCCAGATAAATCTTTGGAATTGGAAGA GGAAGAGATTCAAATGAACGACAGTTCAAACCTGAGTTGTGAACAGGAGAAACCAATGCA CTTGGAAATAGAAGATTCTGGTCCTCTTATTGATATACCTTCTGAGACAGAAGGTTCTGT TTTTATGGAAACTCAAATGCTGCCTTAGAAATCACTCCTAGATGAAATGTTTCTCATAAT AACTTGTCAAGAACTTTTTAGAGTTGTTACATAAAAATAATTGCTGTGTAAAAAAAAAAA AAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_138408 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138408.2, NP_612417.1 |
| RefSeq Size | 963 bp |
| RefSeq ORF | 642 bp |
| Locus ID | 112495 |
| UniProt ID | Q969F1 |
| Gene Summary | RNA polymerases are unable to initiate RNA synthesis in the absence of additional proteins called general transcription factors (GTFs). GTFs assemble in a complex on the DNA promoter and recruit the RNA polymerase. GTF3C family proteins (e.g., GTF3C1, MIM 603246) are essential for RNA polymerase III to make a number of small nuclear and cytoplasmic RNAs, including 5S RNA (MIM 180420), tRNA, and adenovirus-associated (VA) RNA of both cellular and viral origin.[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204285 | GTF3C6 (Myc-DDK-tagged)-Human general transcription factor IIIC, polypeptide 6, alpha 35kDa (GTF3C6) |
CNY 2400.00 |
|
| RC204285L3 | Lenti ORF clone of Human general transcription factor IIIC, polypeptide 6, alpha 35kDa (GTF3C6), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204285L4 | Lenti ORF clone of Human general transcription factor IIIC, polypeptide 6, alpha 35kDa (GTF3C6), mGFP tagged |
CNY 5890.00 |
|
| RG204285 | GTF3C6 (tGFP-tagged) - Human general transcription factor IIIC, polypeptide 6, alpha 35kDa (GTF3C6) |
CNY 4000.00 |
