MTH1 (NUDT1) (NM_198952) Human Untagged Clone
CAT#: SC319885
NUDT1 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3B
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MTH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_198952.1
AAGCGGCGGTGCAGGTTTCTTGCCTTGATGTACTGGAGCAATCAGATCACACGGCGGCTT
GGAGAGTGAGTGCAAGGTTTTATGAGTGGAATTAGCCCTCAGCAGATGGGGGAGCCAGAA GGCAGTTGGAGTGGGAAGAACCCAGGGACCATGGGCGCCTCCAGGCTCTATACCCTGGTG CTGGTCCTGCAGCCTCAGCGAGTTCTCCTGGGCATGAAAAAGCGAGGCTTCGGGGCCGGC CGGTGGAATGGCTTTGGGGGCAAAGTGCAAGAAGGAGAGACCATCGAGGATGGGGCTAGG AGGGAGCTGCAGGAGGAGAGCGGTCTGACAGTGGACGCCCTGCACAAGGTGGGCCAGATC GTGTTTGAGTTCGTGGGCGAGCCTGAGCTCATGGACGTGCATGTCTTCTGCACAGACAGC ATCCAGGGGACCCCCGTGGAGAGCGACGAAATGCGCCCATGCTGGTTCCAGCTGGATCAG ATCCCCTTCAAGGACATGTGGCCCGACGACAGCTACTGGTTTCCACTCCTGCTTCAGAAG AAGAAATTCCACGGGTACTTCAAGTTCCAGGGTCAGGACACCATCCTGGACTACACACTC CGCGAGGTGGACACGGTCTAGCGGGAGCCCAGGGCAGCCCCTGGGCAGGAGACGTGGCTG CTGAACAGCCGCAAACCATCTTCACCTGTGGGCATTGAGTGGCGCAGAGCCGGGTTTCAT CTGGAATTAACTGGATGGAAGGGAAAATAAAGCTATCTAGCGGTGAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_198952 |
Insert Size | 800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198952.1, NP_945190.1 |
RefSeq Size | 813 bp |
RefSeq ORF | 540 bp |
Locus ID | 4521 |
UniProt ID | P36639 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A rare single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Dec 2018] Transcript Variant: This variant (3B) differs in the 5' UTR and 5' coding region compared to variant 1, resulting in translation initiation at an upstream ATG and an isoform (p22, also known as MTH1b) with a longer N-terminus compared to isoform p18. Variants 2B, 3B, and 4B encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201148 | NUDT1 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3B |
CNY 3600.00 |
|
RC201148L3 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3B, Myc-DDK-tagged |
CNY 5890.00 |
|
RC201148L4 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3B, mGFP tagged |
CNY 5890.00 |
|
RG201148 | NUDT1 (tGFP-tagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), transcript variant 3B |
CNY 5200.00 |