RSU1 (NM_012425) Human Untagged Clone

CAT#: SC319710

RSU1 (untagged)-Human Ras suppressor protein 1 (RSU1), transcript variant 1



  "NM_012425" in other vectors (4)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
RSU1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RSP-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC319710 sequence for NM_012425 edited (data generated by NextGen Sequencing)


ATGTCCAAGTCTCTGAAGAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCCGAGGTGGACATGAGTG
ACCGGGGCATCTCCAACATGCTGGATGTCAACGGCCTCTTTACCTTATCCCATATCACACAACTGGTCCT
CAGCCATAACAAGCTAACAATGGTGCCACCGAACATCGCAGAACTGAAGAATTTGGAGGTGCTCAACTTT
TTTAATAACCAAATCGAGGAGCTGCCCACACAGATCAGTAGCCTTCAGAAACTCAAACACCTGAACCTTG
GCATGAACAGGCTGAACACTTTGCCACGAGGCTTCGGCTCCCTGCCAGCTCTTGAGGTTCTGGACTTGAC
GTACAACAACTTGAGCGAAAATTCTCTTCCTGGAAACTTCTTCTACCTGACCACCCTGCGTGCACTCTAT
CTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCC
TTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACCCAGCTTAAAGAGCTCCACAT
TCAGGGGAACCGCCTCACCGTTCTGCCCCCAGAACTAGGAAACTTGGATTTAACTGGCCAGAAGCAGGTA
TTCAAAGCAGAGAACAATCCCTGGGTGACCCCCATTGCAGACCAGTTCCAGCTTGGCGTGTCCCATGTTT
TTGAGTATATCCGTTCTGAGACATACAAATACCTCTACGGCAGACACATGCAGGCCAACCCAGAACCACC
GAAGAAGAATAATGACAAATCGAAAAAGATCAGCCGGAAACCCCTGGCAGCCAAGAACAGATAA


Clone variation with respect to NM_012425.3
Restriction Sites Please inquire     
ACCN NM_012425
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012425.3, NP_036557.1
RefSeq Size 3769 bp
RefSeq ORF 834 bp
Locus ID 6251
UniProt ID Q15404
Domains LRR, LRR_TYP, LRR_PS
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that is involved in the Ras signal transduction pathway, growth inhibition, and nerve-growth factor induced differentiation processes, as determined in mouse and human cell line studies. In mouse, the encoded protein was initially isolated based on its ability to inhibit v-Ras transformation. Multiple alternatively spliced transcript variants for this gene have been reported; one of these variants was found only in glioma tumors. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...