SPANXE (NM_145665) Human Untagged Clone
CAT＃: SC319691
SPANXE (untagged)-Human SPANX family, member E (SPANXE)
CNY 1200.00
CNY 2950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SPANX-E |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_145665.1
GGGTATATACAGGGAGGGCAAGAGCTCCGGGCCACTGCGAAGATTCAAAACCTACAAAAG
CCTGCCGCTGACATTGAAGAACCAATATATACAATGGACAAACAATCCAGTGCCGGCGGG GTGAAGAGGAGCGTCCCCTGTGATTCCAACGAGGCCAACGAGATGATGCCGGAGACCTCG AGTGGGTACTCAGACCCGCAACCTGCTCCGAAAAAACTAAAAACATCTGAGTCCTCGACC ATACTAGTGGTTCGCTACAGGAGGAACGTGAAAAGAACATCTCCAGAGGAACTGCTGAAT GACCACGCCCGAGAGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATGGAA ATAATGGTTGAAATACCTGCAAAGTAGCAAGAAGCTACATCTCTCAACCTTGGGCAATGA AAATAAAGTTTGAGAAGCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_145665 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_145665.1, NP_663698.1 |
| RefSeq Size | 469 bp |
| RefSeq ORF | 294 bp |
| Locus ID | 171489 |
| Gene Summary | Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene encodes a sperm protein that contains a consensus nuclear localization signal but, although a role in spermatogenesis is suggested, the specific function of this family member has not yet been determined. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202803 | SPANXE (Myc-DDK-tagged)-Human SPANX family, member E (SPANXE) |
CNY 3990.00 |
|
| RC202803L3 | Lenti-ORF clone of SPANXE (Myc-DDK-tagged)-Human SPANX family, member E (SPANXE) |
CNY 5890.00 |
|
| RC202803L4 | Lenti-ORF clone of SPANXE (mGFP-tagged)-Human SPANX family, member E (SPANXE) |
CNY 5890.00 |
|
| RG202803 | SPANXE (tGFP-tagged) - Human SPANX family, member E (SPANXE) |
CNY 3400.00 |
