CEBP Beta (CEBPB) (NM_005194) Human Untagged Clone
CAT#: SC319561
CEBPB (untagged)-Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB)
CNY 3656.00
| Cited in 11 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C/EBP-beta; IL6DBP; NF-IL6; TCF5 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_005194.2
GAGCCGCGCACGGGACTGGGAAGGGGACCCACCCGAGGGTCCAGCCACCAGCCCCCTCAC
TAATAGCGGCCACCCCGGCAGCGGCGGCAGCAGCAGCAGCGACGCAGCGGCGACAGCTCA GAGCAGGGAGGCCGCGCCACCTGCGGGCCGGCCGGAGCGGGCAGCCCCAGGCCCCCTCCC CGGGCACCCGCGTTCATGCAACGCCTGGTGGCCTGGGACCCAGCATGTCTCCCCCTGCCG CCGCCGCCGCCTGCCTTTAAATCCATGGAAGTGGCCAACTTCTACTACGAGGCGGACTGC TTGGCTGCTGCGTACGGCGGCAAGGCGGCCCCCGCGGCGCCCCCCGCGGCCAGACCCGGG CCGCGCCCCCCCGCCGGCGAGCTGGGCAGCATCGGCGACCACGAGCGCGCCATCGACTTC AGCCCGTACCTGGAGCCGCTGGGCGCGCCGCAGGCCCCGGCGCCCGCCACGGCCACGGAC ACCTTCGAGGCGGCTCCGCCCGCGCCCGCCCCCGCGCCCGCCTCCTCCGGGCAGCACCAC GACTTCCTCTCCGACCTCTTCTCCGACGACTACGGGGGCAAGAACTGCAAGAAGCCGGCC GAGTACGGCTACGTGAGCCTGGGGCGCCTGGGGGCTGCCAAGGGCGCGCTGCACCCCGGC TGCTTCGCGCCCCTGCACCCACCGCCCCCGCCGCCGCCGCCGCCCGCCGAGCTCAAGGCG GAGCCGGGCTTCGAGCCCGCGGACTGCAAGCGGAAGGAGGAGGCCGGGGCGCCGGGCGGC GGCGCAGGCATGGCGGCGGGCTTCCCGTACGCGCTGCGCGCTTACCTCGGCTACCAGGCG GTGCCGAGCGGCAGCAGCGGGAGCCTCTCCACGTCCTCCTCGTCCAGCCCGCCCGGCACG CCGAGCCCCGCTGACGCCAAGGCGCCCCCGACCGCCTGCTACGCGGGGGCCGCGCCGGCG CCCTCGCAGGTCAAGAGCAAGGCCAAGAAGACCGTGGACAAGCACAGCGACGAGTACAAG ATCCGGCGCGAGCGCAACAACATCGCCGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGC AACCTGGAGACGCAGCACAAGGTCCTGGAGCTCACGGCCGAGAACGAGCGGCTGCAGAAG AAGGTGGAGCAGCTGTCGCGCGAGCTCAGCACCCTGCGGAACTTGTTCAAGCAGCTGCCC GAGCCCCTGCTCGCCTCCTCCGGCCACTGCTAGCGCGGCCCCCGCGCGCGTCCCCCTGCC GGCCGGGGCTGAGACTCCGGGGAGCGCCCGCGCCCGCGCCCTCGCCCCCGCCCCCGGCGG CGCCGGCAAAACTTTGGCACTGGGGCACTTGGCAGCGCGGGGAGCCCGTCGGTAATTTTA ATATTTTATTATATATATATATCTATATTTTTGTCCAAACCAACCGCACATGCAGATGGG GCTCCCGCCCGTGGTGTTATTTAAAGAAGAAACGTCTATGTGTACAGATGAATGATAAAC TCTCTGCTTCTCCCTCTGCCCCTCTCCAGGCGCCGGCGGGCGGGCCGGTTTCGAAGTTGA TGCAATCGGTTTAAACATGGCTGAACGCGTGTGTACACGGGACTGACGCAACCCACGTGT AACTGTCAGCCGGGCCCTGAGTAATCGCTTAAAGATGTTCCTACGGGCTTGTTGCTGTTG ATGTTTTGTTTTGTTTTGTTTTTTGGTCTTTTTTTGTATTATAAAAAATAATCTATTTCT ATGAGAAAAGAGGCGTCTGTATATTTTGGGAATCTTTTCCGTTTCAAGCATTAAGAACAC TTTTAATAAACTTTTTTTTGAGAATGGTTAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005194 |
| Insert Size | 1038 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005194.2, NP_005185.2 |
| RefSeq Size | 1837 bp |
| RefSeq ORF | 1038 bp |
| Locus ID | 1051 |
| UniProt ID | P17676 |
| Domains | BRLZ |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
| Gene Summary | This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013] Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform (a, also known as LAP*) represented in this RefSeq results from translation initiation at the 5' most AUG start codon and is the longest isoform. |
Citations (11)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Transcriptomic analysis of brain tissues identifies a role for CCAAT enhancer binding protein β in HIV-associated neurocognitive disorder
,Canchi, S;Swinton, MK;Rissman, RA;Fields, JA;,
J Neuroinflammation
,PubMed ID 32276639
[CEBPB]
|
|
C/EBPβ-1 promotes transformation and chemoresistance in Ewing sarcoma cells
,Gardiner, JD;Abegglen, LM;Huang, X;Carter, BE;Schackmann, EA;Stucki, M;Paxton, CN;Lor Randall, R;Amatruda, JF;Putnam, AR;Kovar, H;Lessnick, SL;Schiffman, JD;,
Oncotarget
,PubMed ID 28148901
[CEBPB]
|
|
Krüppel-like factor 4 (KLF4) regulates the miR-183~96~182 cluster under physiologic and pathologic conditions
,Segura, MF;Jubierre, L;Li, S;Soriano, A;Koetz, L;Gaziel-Sovran, A;Masanas, M;Kleffman, K;Dankert, JF;Walsh, MJ;Hernando, E;,
Oncotarget
,PubMed ID 28412746
[CEBPB]
|
|
Derivate isocorydine inhibits cell proliferation in hepatocellular carcinoma cell lines by inducing G2/M cell cycle arrest and apoptosis
,Chen, L;Tian, H;Li, M;Ge, C;Zhao, F;Zhang, L;Li, H;Liu, J;Wang, T;Yao, M;Li, J;,
Tumour Biol.
,PubMed ID 26596832
[CEBPB]
|
|
Tumor cell-secreted angiogenin induces angiogenic activity of endothelial cells by suppressing miR-542-3p
,He, T;Qi, F;Jia, L;Wang, S;Wang, C;Song, N;Fu, Y;Li, L;Luo, Y;,
Cancer Lett.
,PubMed ID 26272182
[CEBPB]
|
|
ATF4 Gene Network Mediates Cellular Response to the Anticancer PAD Inhibitor YW3-56 in Triple Negative Breast Cancer Cells
,Wang, S;Chen, XA;Hu, J;Jiang, JK;Li, Y;Chen-Salis, KY;Gu, Y;Chen, G;Thomas, C;Pugh, BF;Wang, Y;,
Mol. Cancer Ther.
,PubMed ID 25612620
[CEBPB]
|
|
Intestinal neuroendocrine cells and goblet cells are mediators of IL-17A-amplified epithelial IL-17C production in human inflammatory bowel disease
,Friedrich, M;Diegelmann, J;Schauber, J;Auernhammer, CJ;Brand, S;,
Mucosal Immunol
,PubMed ID 25492478
[CEBPB]
|
|
C/EBP Transcription Factors in Human Squamous Cell Carcinoma: Selective Changes in Expression of Isoforms Correlate with the Neoplastic State
,Anand, S;Ebner, J;Warren, CB;Raam, MS;Piliang, M;Billings, SD;Maytin, EV;,
PLoS ONE
,PubMed ID 25402211
[CEBPB]
|
|
The CCAAT/Enhancer-Binding Protein Beta-2 Isoform (CEBPß-2) Upregulates Galectin-7 Expression in Human Breast Cancer Cells
,Campion, CG;Labrie, M;Grosset, AA;St-Pierre, Y;,
PLoS ONE
,PubMed ID 24789216
[CEBPB]
|
|
Herpes Simplex Virus Type 2 Infection of Human Epithelial Cells Induces CXCL9 Expression and CD4+ T Cell Migration via Activation of p38-CCAAT/Enhancer-Binding Protein-ß Pathway
,Wenjie Huang, Kai Hu, Sukun Luo, Mudan Zhang, Chang Li, Wei Jin, Yalan Liu, George E. Griffin, Robin J. Shattock, and Qinxue Hu,
J. Immunol., Jun 2012; 188: 6247 - 6257.
[CEBPB]
|
|
C/EBP-ß Modulates Transcription of Tubulointerstitial Nephritis Antigen in Obstructive Uropathy
,Ping Xie, Lin Sun, Baibasawata Nayak, Yoshisuke Haruna, Fu-you Liu, Naoki Kashihara, and Yashpal S. Kanwar,
. Am. Soc. Nephrol., Apr 2009; 20: 807 - 819.
[CEBPB]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205882 | CEBPB (Myc-DDK-tagged)-Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) |
CNY 5488.00 |
|
| RC205882L1 | Lenti ORF clone of Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC205882L2 | Lenti ORF clone of Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB), mGFP tagged |
CNY 5890.00 |
|
| RC205882L3 | Lenti ORF clone of Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC205882L4 | Lenti ORF clone of Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB), mGFP tagged |
CNY 7888.00 |
|
| RG205882 | CEBPB (tGFP-tagged) - Human CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) |
CNY 7088.00 |
其它CEBP Beta产品
