C1QA (NM_015991) Human Untagged Clone

CAT#: SC319556

C1QA (untagged)-Human complement component 1, q subcomponent, A chain (C1QA)



  "NM_015991" in other vectors (6)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
C1QA Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3870.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_015991.2 CTGGGCGGAGGGCAGGAGCATCCAGTTGGAGTTGACAACAGGAGGCAGAGGCATCATGGA
GGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATGGTGAC
CGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGCAGACG
GGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGGACAGG
CATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGCAAGGT
GGGCTACCCAGGGCCCAGCGGCCCCCTCGGGGCCCGTGGCATCCCGGGAATTAAAGGCAC
CAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATTCGGCG
GAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAGGAAGA
ACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTACTTCAC
CTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGGGGCCA
GGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTGGTGTC
AGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGACCCCAA
AAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTCATCTT
CCCATCTGCCTGAGCCAGGGAAGGACCCCCTCCCCCACCCACCTCTCTGGCTTCCATGCT
CCGCCTGTAAAATGGGGGCGCTATTGCTTCAGCTGCTGAAGGGAGGGGGCTGGCTCTGAG
AGCCCCAGGACTGGCTGCCCCGTGACACATGCTCTAAGAAGCTCGTTTCTTAGACCTCTT
CCTGGAATAAACATCTGTGTCTGTGTCTGCTGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_015991
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015991.2, NP_057075.1
RefSeq Size 1098 bp
RefSeq ORF 738 bp
Locus ID 712
UniProt ID P02745
Domains C1Q, Collagen
Protein Families Secreted Protein
Protein Pathways Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus
Gene Summary This gene encodes the A-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Transcript Variant: This variant (1) uses an alternate splice site in the 5' UTR, compared to variant (2). Variants 1-3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...