NTAN1 (NM_173474) Human Untagged Clone
CAT＃: SC319519
NTAN1 (untagged)-Human N-terminal asparagine amidase (NTAN1)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PNAA; PNAD |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_173474.2
CCGCGATGCCGCTGCTCGTCGAGGGGCGGCGAGTGCGGCTGCCGCAGTCAGCCGGGGACC
TCGTCCGAGCCCACCCGCCTTTGGAGGAAAGAGCCAGACTTCTCAGAGGTCAGTCTGTTC AACAAGTGGGACCCCAGGGCCTTCTGTATGTTCAGCAAAGAGAGCTTGCAGTGACCTCCC CAAAGGATGGCTCCATCTCCATTCTGGGTTCTGATGATGCCACTACTTGTCACATTGTGG TCCTGAGGCACACAGGTAATGGGGCCACCTGCTTGACACATTGTGACGGAACCGACACCA AAGCTGAGGTCCCCTTGATCATGAACTCCATAAAATCCTTTTCTGACCACGCTCAATGTG GAAGGCTGGAAGTACACCTTGTTGGAGGCTTCAGTGACGACAGGCAGTTGTCACAAAAAC TCACTCATCAACTTCTTAGTGAATTTGACAGGCAAGAAGATGACATTCACTTAGTGACAT TATGTGTGACAGAATTAAATGACCGGGAAGAAAACGAAAACCACTTTCCAGTAATATATG GCATTGCTGTCAACATTAAGACTGCAGAGATTTACAGAGCATCCTTTCAAGATCGGGGTC CGGAGGAGCAGCTTCGTGCTGCGCGAACTTTAGCAGGAGGACCAATGATTAGCATTTATG ATGCAGAGACAGAACAACTTCGTATAGGACCGTACTCCTGGACACCATTTCCACATGTGG ATTTCTGGTTGCACCAAGATGACAAGCAAATACTAGAGAATCTTTCCACTTCGCCTCTGG CTGAGCCACCCCACTTTGTTGAACATATTAGATCTACCTTGATGTTTTTAAAAAAACACC CATCTCCAGCTCACACACTGTTTTCTGGAAATAAAGCCCTACTCTACAAAAAAAATGAAG ATGGCTTGTGGGAAAAGATCTCTTCTCCAGGAAGTTAAAAAACATGAATTACCAAAGAAA GCACCTTCTTGGCCTGACAGACCATTGGTGGGGCTGGCACGAATCCAGATCTGGATCCTA CATCTGTTGGGTCTTAGGCCTCCTTCCCTCCTCAGTGTCTTTCAAATGACTTTCATCAAA TGACTTTCAAAATAAAACCTTATTTTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_173474 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_173474.2, NP_775745.1 |
| RefSeq Size | 1137 bp |
| RefSeq ORF | 933 bp |
| Locus ID | 123803 |
| UniProt ID | Q96AB6 |
| Gene Summary | The protein encoded by this gene functions in a step-wise process of protein degradation through the N-end rule pathway. This protein acts as a tertiary destabilizing enzyme that deamidates N-terminal L-Asn residues on proteins to produce N-terminal L-Asp. L-Asp substrates are subsequently conjugated to L-Arg, which is recognized by specific E3 ubiquitin ligases and targeted to the proteasome. Pseudogenes of this gene are located on the long arms of chromosomes 8, 10 and 12. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) represents the longesr transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205697 | NTAN1 (Myc-DDK-tagged)-Human N-terminal asparagine amidase (NTAN1) |
CNY 2400.00 |
|
| RC205697L3 | Lenti ORF clone of Human N-terminal asparagine amidase (NTAN1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC205697L4 | Lenti ORF clone of Human N-terminal asparagine amidase (NTAN1), mGFP tagged |
CNY 5890.00 |
|
| RG205697 | NTAN1 (tGFP-tagged) - Human N-terminal asparagine amidase (NTAN1) |
CNY 4000.00 |
