BAG1 (NM_004323) Human Untagged Clone

CAT#: SC319483

BAG1 (untagged)-Human BCL2-associated athanogene (BAG1), transcript variant 1



  "NM_004323" in other vectors (6)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Anti-BAG1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAG-1; HAP; RAP46
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004323.4 GAGACGCCGCGCTCAGCTTCCATCGCTGGGCGGTCAACAAGTGCGGGCCTGGCTCAGCGC
GGGGGGGCGCGGAGACCGCGAGGCGACCGGGAGCGGCTGGGTTCCCGGCTGCGCGCCCTT
CGGCCAGGCCGGGAGCCGCGCCAGTCGGAGCCCCCGGCCCAGCGTGGTCCGCCTCCCTCT
CGGCGTCCACCTGCCCGGAGTACTGCCAGCGGGCATGACCGACCCACCAGGGGCGCCGCC
GCCGGCGCTCGCAGGCCGCGGATGAAGAAGAAAACCCGGCGCCGCTCGACCCGGAGCGAG
GAGTTGACCCGGAGCGAGGAGTTGACCCTGAGTGAGGAAGCGACCTGGAGTGAAGAGGCG
ACCCAGAGTGAGGAGGCGACCCAGGGCGAAGAGATGAATCGGAGCCAGGAGGTGACCCGG
GACGAGGAGTCGACCCGGAGCGAGGAGGTGACCAGGGAGGAAATGGCGGCAGCTGGGCTC
ACCGTGACTGTCACCCACAGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGC
AGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCA
CAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTG
TCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCA
CAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCT
GACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAG
GATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAG
TTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAAATTTCAAAGACAGT
AGATTGAAAAGGAAAGGCTTGGTAAAAAAGGTTCAGGCATTCCTAGCCGAGTGTGACACA
GTGGAGCAGAACATCTGCCAGGAGACTGAGCGGCTGCAGTCTACAAACTTTGCCCTGGCC
GAGTGAGGTGTAGCAGAAAAAGGCTGTGCTGCCCTGAAGAATGGCGCCACCAGCTCTGCC
GTCTCTGGAGCGGAATTTACCTGATTTCTTCAGGGCTGCTGGGGGCAACTGGCCATTTGC
CAATTTTCCTACTCTCACACTGGTTCTCAATGAAAAATAGTGTCTTTGTGATTTTGAGTA
AAGCTCCTATCTGTTTTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004323
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004323.4, NP_004314.4
RefSeq Size 3885 bp
RefSeq ORF 1038 bp
Locus ID 573
UniProt ID Q99933
Domains UBQ, BAG
Protein Families Druggable Genome
Gene Summary The oncogene BCL2 is a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. The protein encoded by this gene binds to BCL2 and is referred to as BCL2-associated athanogene. It enhances the anti-apoptotic effects of BCL2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. Multiple protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) initiation codon, and three alternative downstream AUG initiation codons. A related pseudogene has been defined on chromosome X. [provided by RefSeq, Feb 2010]
Transcript Variant: This transcript (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longest isoform (BAG-1L or p50) is derived from an upstream non-AUG (CUG) start codon, while three shorter isoforms are derived from downstream AUG start codons. The longest isoform (BAG-1L) is represented in this RefSeq. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the longest human BAG1 isoform, known as BAG-1L or p50, as described in the literature, including PMIDs 9396724, 9679980, 9747877 and 17662274. This isoform initiates translation at a non-AUG (CUG) start codon that is well-conserved and present in a strong Kozak signal context. Alternative translation initiation at downstream AUG start codons produces three additional isoforms with shorter N-termini, known as BAG-1M or p46, BAG-1S or p36 (also known as p33), and p29. The most abundant of the shorter isoforms, BAG-1S, is represented by CCDS 55301.1. Evidence in PMIDs 9747877 and 17662274 indicates that these isoforms have distinct subcellular distributions, which may contribute to the multifunctionality of the protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...