POLR2E (NM_002695) Human Untagged Clone
CAT#: SC319449
POLR2E (untagged)-Human polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (POLR2E)
CNY 2400.00
CNY 3990.00
Cited in 1 publication. |
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hRPB25; hsRPB5; RPABC1; RPB5; XAP4 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002695.2
GGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAAT
CCGCAAGACCATCATGCAGCTGTGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCT TGACCAGACCCTGGAGGAGTTCAAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCC GCGGCGCACGGACCTCACCGTGCTGGTGGCCCACAACGATGACCCCACCGACCAGATGTT TGTGTTCTTTCCAGAGGAGCCCAAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCG CATGCAGGAGGAGAACATCACACGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTC CGCCAAGCAGTCCCTGGTCGACATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCA GGAGCTGCTCATCAACATCACGGAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAA GGAGGAGGTGACAGAGCTGCTGGCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGAT CCAGGCGGGGGACCCTGTGGCGCGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGAT CATCCGGCCCAGTGAGACGGCTGGCAGGTACATCACCTACCGGCTGGTGCAGTAGCTACC GCCTGACAGCCCCTAGAGGCGGACACACAGCGACCCCCATCCCTGCAGGACAAACGCCCC TGCCCTGCCAGAATCCGGCCCCCACAGCTCTCACGGCTGCTGCTCCTCTGGACTCCCCAA GGCAGGTGGCCTCCACCCACGTTCTCCCGTCCTGGGGTGAGGCTTCCTGTGGCCCAGCCC GCCCCATTCACCTGTGGATTTGTGCGAGATGCAGCCTCAGAAGGAACAAGGCCCCCAGAG GGAGGTCACCTGGGGGCAGCTGGTGCCGGGTCTTCACCCAGACCACGCTGGGTCCCCTCT GTTGGGGGTTTGGGGTCCGGGTCTCCCACCAGCCACTGCTTCCTCCTGGGCCCTCGGCCT TCCACCCCTCGTCTTCCCTCCCTCGGGGGCCCTGATGCGTGGCGGCCCCCACCCGGCCTC GGCTCTTTACTCCATTCACAGCCGTGCACGCGCTCAAGCCACCAGGGTGCGAGATGCCAG CTCTGGAGTTCTCGGTTGTTGTAGGAGGTTGGGTGTTTTCAAATGGTAAAGATGTTTTGA GCAAATAAATTTGCTTGATACAGAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002695 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002695.2, NP_002686.2 |
RefSeq Size | 1238 bp |
RefSeq ORF | 633 bp |
Locus ID | 5434 |
UniProt ID | P19388 |
Domains | RNA_pol_Rpb5_C, RNA_pol_Rpb5_N |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase |
Gene Summary | This gene encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Analysis of URI Nuclear Interaction with RPB5 and Components of the R2TP/Prefoldin-Like Complex
,null,
PLoS ONE
,PubMed ID 23667685
[POLR2E]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201266 | POLR2E (Myc-DDK-tagged)-Human polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (POLR2E) |
CNY 2400.00 |
|
RC201266L3 | Lenti ORF clone of Human polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (POLR2E), Myc-DDK-tagged |
CNY 5890.00 |
|
RC201266L4 | Lenti ORF clone of Human polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (POLR2E), mGFP tagged |
CNY 5890.00 |
|
RG201266 | POLR2E (tGFP-tagged) - Human polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (POLR2E) |
CNY 4000.00 |