PHAX (NM_032177) Human Untagged Clone
CAT＃: SC319313
PHAX (untagged)-Human phosphorylated adaptor for RNA export (PHAX)
CNY 3656.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | RNUXA |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_032177.2
CAGCGCAGCGCACCGCGGGAAGATGGCGTTGGAGGTCGGCGATATGGAAGATGGGCAGCT
TTCCGACTCGGATTCCGACATGACGGTCGCACCCAGCGACAGGCCGCTGCAATTGCCAAA AGTGCTAGGTGGCGACAGTGCTATGAGGGCCTTCCAGAACACGGCAACTGCATGTGCACC AGTATCACATTATCGAGCTGTTGAAAGTGTGGATTCAAGTGAAGAAAGTTTTTCTGATTC AGATGATGATAGCTGTCTTTGGAAACGCAAACGACAGAAATGTTTTAACCCTCCTCCCAA ACCAGAGCCTTTTCAGTTTGGCCAGAGCAGTCAGAAACCACCTGTTGCTGGAGGAAAGAA GATTAACAACATATGGGGTGCTGTGCTGCAGGAACAGAATCAAGATGCAGTGGCCACTGA ACTTGGTATCTTGGGAATGGAGGGCACTATTGACAGAAGCAGACAATCCGAGACCTACAA TTATTTGCTTGCCAAGAAACTTAGGAAGGAATCTCAAGAGCATACAAAAGATCTAGACAA GGAACTAGATGAATATATGCATGGTGGCAAAAAAATGGGATCAAAGGAAGAGGAAAATGG GCAAGGTCATCTCAAAAGGAAACGACCTGTCAAAGACAGGCTAGGGAACAGACCAGAAAT GAACTATAAAGGTCGATACGAGATCACAGCGGAAGATTCTCAAGAGAAAGTGGCTGATGA AATTTCATTCAGGTTACAGGAACCAAAGAAAGACCTGATAGCCCGAGTAGTGAGGATTAT TGGTAACAAAAAGGCAATTGAACTTCTGATGGAAACCGCTGAAGTTGAACAAAATGGTGG TCTCTTTATAATGAATGGTAGTCGAAGAAGAACACCAGGTGGAGTTTTTCTGAATCTCTT GAAAAACACTCCTAGTATCAGCGAGGAACAAATTAAGGACATTTTCTACATTGAAAACCA AAAGGAATATGAAAATAAAAAAGCTGCTAGGAAGAGGAGAACACAAGTGTTGGGGAAAAA GATGAAACAAGCTATTAAAAGTCTAAATTTTCAAGAAGATGATGATACATCACGAGAAAC TTTTGCAAGTGACACGAATGAGGCCTTGGCCTCTCTTGATGAGTCACAGGAAGGACATGC AGAAGCCAAGTTGGAGGCAGAGGAAGCCATTGAAGTTGATCATTCTCATGATTTGGACAT CTTTTAAGTACATTTTCAACAGTTTGAGGACTAAGCCTTTCTAAAATAACATTGTAATAA ACCATTTTTACTGAGATTGCAACGTTTTGCACTGATAAACATGAGAATCTGGAAAAAAAA AAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_032177 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032177.2, NP_115553.2 |
| RefSeq Size | 1751 bp |
| RefSeq ORF | 1185 bp |
| Locus ID | 51808 |
| UniProt ID | Q9H814 |
| Gene Summary | A phosphoprotein adapter involved in the XPO1-mediated U snRNA export from the nucleus. Bridge components required for U snRNA export, the cap binding complex (CBC)-bound snRNA on the one hand and the GTPase Ran in its active GTP-bound form together with the export receptor XPO1 on the other. Its phosphorylation in the nucleus is required for U snRNA export complex assembly and export, while its dephosphorylation in the cytoplasm causes export complex disassembly. It is recycled back to the nucleus via the importin alpha/beta heterodimeric import receptor. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Its compartmentalized phosphorylation cycle may also contribute to the directionality of export. Binds strongly to m7G-capped U1 and U5 small nuclear RNAs (snRNAs) in a sequence-unspecific manner and phosphorylation-independent manner (By similarity). Plays also a role in the biogenesis of U3 small nucleolar RNA (snoRNA). Involved in the U3 snoRNA transport from nucleoplasm to Cajal bodies. Binds strongly to m7G-capped U3, U8 and U13 precursor snoRNAs and weakly to trimethylated (TMG)-capped U3, U8 and U13 snoRNAs. Binds also to telomerase RNA.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203376 | PHAX (Myc-DDK-tagged)-Human phosphorylated adaptor for RNA export (PHAX) |
CNY 3656.00 |
|
| RC203376L3 | Lenti ORF clone of Human phosphorylated adaptor for RNA export (PHAX), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203376L4 | Lenti ORF clone of Human phosphorylated adaptor for RNA export (PHAX), mGFP tagged |
CNY 5890.00 |
|
| RG203376 | PHAX (tGFP-tagged) - Human phosphorylated adaptor for RNA export (PHAX) |
CNY 5256.00 |
