NAT8 (NM_003960) Human Untagged Clone
CAT#: SC319260
NAT8 (untagged)-Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8)
CNY 2400.00
CNY 2950.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATase2; CCNAT; CML1; GLA; Hcml1; TSC501; TSC510 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003960.3
GGGGGAGACGGTATCTCCTGGATGCCAGTGAGCGGCTGAGAGCTGAAGCTCCCTGGACAC
TCAAGGCTCTTGTGGTGACAGTCTGACGTAAAGGCGTGCAGGGAGGCCTAGCTCTGTCTC CTGGACTTAGAGATTTCAGACACAGAAGTCTGTCCATGGCTCCTTGTCACATCCGCAAAT ACCAGGAGAGCGACCGCCAGTGGGTTGTGGGCTTGCTCTCCCGGGGGATGGCCGAGCATG CCCCAGCCACCTTCCGGCAATTGCTGAAGCTGCCTCGAACCCTCATACTCTTACTTGGGG GGCCCCTCGCCCTACTCCTGGTCTCTGGATCCTGGCTTCTAGCCCTCGTGTTCAGCATCA GCCTCTTCCCTGCCCTGTGGTTCCTTGCCAAAAAACCCTGGACGGAGTATGTGGACATGA CATTGTGCACAGACATGTCTGACATTACCAAATCCTACCTGAGTGAGCGTGGCTCCTGCT TCTGGGTGGCTGAGTCTGAAGAGAAGGTGGTGGGCATGGTAGGAGCTCTGCCTGTTGATG ATCCCACCTTGAGGGAGAAGCGGTTGCAGCTGTTTCATCTCTTTGTGGACAGTGAGCACC GTCGTCAGGGGATAGCAAAAGCCCTGGTCAGGACTGTCCTCCAGTTTGCCCGGGACCAGG GCTACAGTGAAGTTATCCTGGACACCGGCACCATCCAGCTCTCTGCTATGGCCCTCTACC AGAGCATGGGCTTCAAGAAGACGGGCCAGTCCTTCTTCTGTGTGTGGGCCAGGCTAGTGG CTCTTCATACAGTTCATTTCATCTACCACCTCCCTTCTTCTAAGGTAGGGAGTCAGTGAT CTCTTTCTGTGTGTATTGGTCAGAATAGAATCCATTCAGCTGTAGCAGCAAGCAATCCCC AACCTTTCACTGCAATGACCTTTCAATGCAATAAAAGCTTATTGTCCATTCAAAAAAAAA AAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003960 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003960.3, NP_003951.3 |
RefSeq Size | 1073 bp |
RefSeq ORF | 684 bp |
Locus ID | 9027 |
UniProt ID | Q9UHE5 |
Domains | Acetyltransf |
Protein Families | Transmembrane |
Gene Summary | This gene, isolated using the differential display method to detect tissue-specific genes, is specifically expressed in kidney and liver. The encoded protein shows amino acid sequence similarity to N-acetyltransferases. A similar protein in Xenopus affects cell adhesion and gastrulation movements, and may be localized in the secretory pathway. A highly similar paralog is found in a cluster with this gene. [provided by RefSeq, Sep 2008] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Molecular Identification of NAT8 as the Enzyme That Acetylates Cysteine S-Conjugates to Mercapturic Acids
,Maria Veiga-da-Cunha, Donatienne Tyteca, Vincent Stroobant, Pierre J. Courtoy, Fred R. Opperdoes, and Emile Van Schaftingen,
J. Biol. Chem., Jun 2010; 285: 18888 - 18898
[NAT8]
|
Two Endoplasmic Reticulum (ER)/ER Golgi Intermediate Compartment-based Lysine Acetyltransferases Post-translationally Regulate BACE1 Levels
,Mi Hee Ko and Luigi Puglielli,
J. Biol. Chem., Jan 2009; 284: 2482 - 2492.
[NAT8]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203157 | NAT8 (Myc-DDK-tagged)-Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8) |
CNY 2400.00 |
|
RC203157L1 | Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), Myc-DDK-tagged |
CNY 4800.00 |
|
RC203157L2 | Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mGFP tagged |
CNY 5890.00 |
|
RC203157L3 | Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), Myc-DDK-tagged |
CNY 5890.00 |
|
RC203157L4 | Lenti ORF clone of Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8), mGFP tagged |
CNY 5890.00 |
|
RG203157 | NAT8 (tGFP-tagged) - Human N-acetyltransferase 8 (GCN5-related, putative) (NAT8) |
CNY 4000.00 |