IDH2 (NM_002168) Human Untagged Clone
CAT#: SC319226
IDH2 (untagged)-Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein
CNY 3656.00
| Cited in 7 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | D2HGA2; ICD-M; IDH; IDHM; IDP; IDPM; mNADP-IDH |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_002168.2
GGCAGCCGGGAGGAGCGGCGCGCGCTCGGACCTCTCCCGCCCTGCTCGTTCGCTCTCCAG
CTTGGGATGGCCGGCTACCTGCGGGTCGTGCGCTCGCTCTGCAGAGCCTCAGGCTCGCGG CCGGCCTGGGCGCCGGCGGCCCTGACAGCCCCCACCTCGCAAGAGCAGCCGCGGCGCCAC TATGCCGACAAAAGGATCAAGGTGGCGAAGCCCGTGGTGGAGATGGATGGTGATGAGATG ACCCGTATTATCTGGCAGTTCATCAAGGAGAAGCTCATCCTGCCCCACGTGGACATCCAG CTAAAGTATTTTGACCTCGGGCTCCCAAACCGTGACCAGACTGATGACCAGGTCACCATT GACTCTGCACTGGCCACCCAGAAGTACAGTGTGGCTGTCAAGTGTGCCACCATCACCCCT GATGAGGCCCGTGTGGAAGAGTTCAAGCTGAAGAAGATGTGGAAAAGTCCCAATGGAACT ATCCGGAACATCCTGGGGGGGACTGTCTTCCGGGAGCCCATCATCTGCAAAAACATCCCA CGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAG TACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCA AAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGC ATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTAT GCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTAC GATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTC GACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCAGGTCCTC AAGTCTTCGGGTGGCTTTGTGTGGGCCTGCAAGAACTATGACGGAGATGTGCAGTCAGAC ATCCTGGCCCAGGGCTTTGGCTCCCTTGGCCTGATGACGTCCGTCCTGGTCTGCCCTGAT GGGAAGACGATTGAGGCTGAGGCCGCTCATGGGACCGTCACCCGCCACTATCGGGAGCAC CAGAAGGGCCGGCCCACCAGCACCAACCCCATCGCCAGCATCTTTGCCTGGACACGTGGC CTGGAGCACCGGGGGAAGCTGGATGGGAACCAAGACCTCATCAGGTTTGCCCAGATGCTG GAGAAGGTGTGCGTGGAGACGGTGGAGAGTGGAGCCATGACCAAGGACCTGGCGGGCTGC ATTCACGGCCTCAGCAATGTGAAGCTGAACGAGCACTTCCTGAACACCACGGACTTCCTC GACACCATCAAGAGCAACCTGGACAGAGCCCTGGGCAGGCAGTAGGGGGAGGCGCCACCC ATGGCTGCAGTGGAGGGGCCAGGGCTGAGCCGGCGGGTCCTCCTGAGCGCGGCAGAGGGT GAGCCTCACAGCCCCTCTCTGGAGGCCTTTCTAGGGGATGTTTTTTTATAAGCCAGATGT TTTTAAAAGCATATGTGTGTTTCCCCTCATGGTGACGTGAGGCAGGAGCAGTGCGTTTTA CCTCAGCCAGTCAGTATGTTTTGCATACTGTAATTTATATTGCCCTTGGAACACATGGTG CCATATTTAGCTACTAAAAAGCTCTTCACAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002168 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002168.2, NP_002159.2 |
| RefSeq Size | 1740 bp |
| RefSeq ORF | 1359 bp |
| Locus ID | 3418 |
| UniProt ID | P48735 |
| Domains | isodh |
| Protein Pathways | Citrate cycle (TCA cycle), Glutathione metabolism, Metabolic pathways |
| Gene Summary | Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Citations (7)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Role of Isocitrate Dehydrogenase 2 on DNA Hydroxymethylation in Human Airway Smooth Muscle Cells
,Yeung, BH;Huang, J;An, SS;Solway, J;Mitzner, W;Tang, WY;,
Am. J. Respir. Cell Mol. Biol.
,PubMed ID 32150688
[IDH2]
|
|
Mutant IDH inhibits HNF4α to block hepatocyte differentiation and promote biliary cancer
,null,
Nature
,PubMed ID 25043045
[IDH2]
|
|
D-2-hydroxyglutarate produced by mutant IDH2 causes cardiomyopathy and neurodegeneration in mice
,Akbay, EA;Moslehi, J;Christensen, CL;Saha, S;Tchaicha, JH;Ramkissoon, SH;Stewart, KM;Carretero, J;Kikuchi, E;Zhang, H;Cohoon, TJ;Murray, S;Liu, W;Uno, K;Fisch, S;Jones, K;Gurumurthy, S;Gliser, C;Choe, S;Keenan, M;Son, J;Stanley, I;Losman, JA;Padera, R;Bronson, RT;Asara, JM;Abdel-Wahab, O;Amrein, PC;Fathi, AT;Danial, NN;Kimmelman, AC;Kung, AL;Ligon, KL;Yen, KE;Kaelin, WG;Bardeesy, N;Wong, KK;,
Genes Dev.
,PubMed ID 24589777
[IDH2]
|
|
Elevated CO2 Levels Cause Mitochondrial Dysfunction and Impair Cell Proliferation *
,null,
The Journal of Biological Chemistry
,PubMed ID 21903582
[IDH2]
|
|
IDH1 and IDH2 mutations in pediatric acute leukemia
,A K Andersson, D W Miller, J A Lynch, A S Lemoff, Z Cai, S B Pounds, I Radtke, B Yan, J D Schuetz, J E Rubnitz, et al.,
Leukemia (7 June 2011) doi:10.1038/leu.2011.133 Original Article
[IDH2]
|
|
Cancer-associated metabolite 2-hydroxyglutarate accumulates in acute myelogenous leukemia with isocitrate dehydrogenase 1 and 2 mutations
,Stefan Gross, Rob A. Cairns, Mark D. Minden, Edward M. Driggers, Mark A. Bittinger, Hyun Gyung Jang, Masato Sasaki, Shengfang Jin, David P. Schenkein, Shinsan M. Su, Lenny Dang, Valeria R. Fantin, and Tak W. Mak,
J. Exp. Med., Feb 2010; 207: 339 - 344
[IDH2]
|
|
IDH1 and IDH2 Mutations in Gliomas
,Hai Yan, D. Williams Parsons, Genglin Jin, Roger McLendon, B. Ahmed Rasheed, Weishi Yuan, Ivan Kos, Ines Batinic-Haberle, Siân Jones, Gregory J. Riggins, Henry Friedman, Allan Friedman, David Reardon, James Herndon, Kenneth W. Kinzler, Victor E. Velculescu, Bert Vogelstein, and Darell D. Bigner,
N. Engl. J. Med., Feb 2009; 360: 765 - 773.
[IDH2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201152 | IDH2 (Myc-DDK-tagged)-Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein |
CNY 5488.00 |
|
| RC201152L1 | Lenti ORF clone of Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC201152L2 | Lenti ORF clone of Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 7888.00 |
|
| RC201152L3 | Lenti ORF clone of Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201152L4 | Lenti ORF clone of Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RG201152 | IDH2 (tGFP-tagged) - Human isocitrate dehydrogenase 2 (NADP+), mitochondrial (IDH2), nuclear gene encoding mitochondrial protein |
CNY 7088.00 |

