Serum Amyloid P (APCS) (NM_001639) Human Untagged Clone

CAT#: SC319221

APCS (untagged)-Human amyloid P component, serum (APCS)



  "NM_001639" in other vectors (6)

CNY 2400.00

CNY 2950.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
APCS mouse monoclonal antibody, clone OTI1D6 (formerly 1D6)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-92n; PTX2; SAP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001639.2 GGGCATGAATATCAGACGCTAGGGGGACAGCCACTGTGTTGTCTGCTACCCTCATCCTGG
TCACTGCTTCTGCTATAACAGCCCTAGGCCAGGAATATGAACAAGCCGCTGCTTTGGATC
TCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTT
GTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCT
CTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTC
TTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTTGGA
GAGTATAGTCTATACATTGGAAGACACAAAGTTACATCCAAAGTTATCGAAAAGTTCCCG
GCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATC
AATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTTTGTGGAAGCTCAGCCC
AAGATTGTCCTGGGGCAGGAACAGGATTCCTATGGGGGCAAGTTTGATAGGAGCCAGTCC
TTTGTGGGAGAGATTGGGGATTTGTACATGTGGGACTCTGTGCTGCCCCCAGAAAATATC
CTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAATATCCTGGACTGGCAGGCTCTGAAC
TATGAAATCAGAGGATATGTCATCATCAAACCCTTGGTGTGGGTCTGAGGTCTTGACTCA
ACGAGAGCACTTGAAAATGAAATGACTGTCTAAGAGATCTGGTCAAAGCAACTGGATACT
AGATCTTACATCTGCAGCTCTTTCTTCTTTGAATTTCCTATCTGTATGTCTGCCTAATTA
AAAAAATATATATTGTATTATGCTACCTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001639
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001639.2, NP_001630.1
RefSeq Size 959 bp
RefSeq ORF 672 bp
Locus ID 325
UniProt ID P02743
Domains PTX
Protein Families Druggable Genome, Secreted Protein
Gene Summary The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...