Centrin 3 (CETN3) (NM_004365) Human Untagged Clone
CAT＃: SC319201
CETN3 (untagged)-Human centrin, EF-hand protein, 3 (CETN3)
CNY 2400.00
CNY 2950.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CDC31; CEN3 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004365.2
GTCGTTCGTGTCTGTTGAACGGCTGTGGGCGTCTTGCTGCCTTGGGTAGGGGGTTAAAAT
CGTTCTTGAGAGGAACGTCTCTGTGCGAAGAGATAATGAGTTTAGCTCTGAGAAGTGAGC TTGTAGTGGACAAAACAAAGAGGAAAAAAAGAAGAGAACTGTCTGAGGAACAGAAACAAG AAATTAAAGATGCTTTTGAACTATTTGATACAGACAAAGATGAAGCAATAGATTATCATG AATTAAAGGTGGCAATGAGAGCCTTGGGGTTTGATGTAAAAAAAGCTGATGTACTGAAGA TTCTTAAAGATTATGACAGAGAAGCCACAGGGAAAATCACCTTTGAAGATTTTAATGAAG TTGTGACAGACTGGATATTGGAAAGAGATCCCCATGAAGAAATACTCAAGGCATTTAAAC TATTTGATGATGATGATTCAGGTAAAATAAGCTTGAGGAATTTGCGACGTGTTGCTAGAG AATTGGGTGAAAACATGAGTGATGAAGAACTTCGAGCTATGATAGAAGAATTTGACAAAG ATGGTGATGGAGAAATAAACCAAGAGGAGTTCATTGCTATTATGACTGGTGACATTTAAA GAATTACAAGGATAAACACTAAGAATGTTGCAGTTACCATCTTATATTCTATTTTTGTGC CTGGAGCCATGTGAAAAAAACCAACTTAGTTCTTTTATCCTAAAGGACCAAAAATAAGCA TCTTATATATCTGTATTTTACTACTGTTAAGTTTCTTTGTATGAACTGTGTTGTTAGTAC TCAGATAGTTTAGCTTTGTATTTATAATAGAGCTTTTATATAAAGTTTTAAAAATTGAAT GTGTGATATGTGTTCTTTGAAGGTTTTTTAATTTAACATTTATAGTCACTTTTTAGTGCA CACATTTTCCAGACTTTCGTTAATAAAATATTTATTTTATTAAAAAAAAAAAAAAAAAAA AAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004365 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004365.2, NP_004356.2 |
| RefSeq Size | 997 bp |
| RefSeq ORF | 504 bp |
| Locus ID | 1070 |
| UniProt ID | O15182 |
| Domains | EFh |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene contains four EF-hand calcium binding domains, and is a member of the centrin protein family. Centrins are evolutionarily conserved proteins similar to the CDC31 protein of S. cerevisiae. Yeast CDC31 is located at the centrosome of interphase and mitotic cells, where it plays a fundamental role in centrosome duplication and separation. Multiple forms of the proteins similar to the yeast centrin have been identified in human and other mammalian cells, some of which have been shown to be associated with centrosome fractions. This protein appears to be one of the most abundant centrins associated with centrosome, which suggests a similar function to its yeast counterpart. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202804 | CETN3 (Myc-DDK-tagged)-Human centrin, EF-hand protein, 3 (CETN3) |
CNY 2400.00 |
|
| RC202804L3 | Lenti ORF clone of Human centrin, EF-hand protein, 3 (CETN3), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC202804L4 | Lenti ORF clone of Human centrin, EF-hand protein, 3 (CETN3), mGFP tagged |
CNY 5890.00 |
|
| RG202804 | CETN3 (tGFP-tagged) - Human centrin, EF-hand protein, 3 (CETN3) |
CNY 4000.00 |
其它Centrin 3产品
