IFT20 (NM_174887) Human Untagged Clone
CAT#: SC319073
IFT20 (untagged)-Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_174887.2
GGTAAACAGGCTCTGTATCCGTGGCAGCGGCCGTGGCAGGCTGGCTGGGTACCGGCTGTC
GCTGACCCAGGAGAAGCTGCCTGTCTACATCAGCCTGGGCTGCAGCGCGCTGCCGCCGCG GGGCCGGCAGCCATGGCCAAGGACATCCTGGGTGAAGCAGGGCTACACTTTGATGAACTG AACAAGCTGAGGGTGTTGGACCCAGAGGTTACCCAGCAGACCATAGAGCTGAAGGAAGAG TGCAAAGACTTTGTGGACAAAATTGGCCAGTTTCAGAAAATAGTTGGTGGTTTAATTGAG CTTGTTGATCAACTTGCAAAAGAAGCAGAAAATGAAAAGATGAAGAGTCTTGCTGTGTCA CCCAGGCTGGAGTGCACTGGTGCAATCTCGGCTCACTGCAAGCTCTGCCTCTCAGATTCA AGCGATTCTCCCACCTCACCCTCCCGAGTAGGTGGGACTACAGGCCATCGGTGCTCGGAA CTTGCTCAAATCTATAGCAAAGCAGAGAGAAGCTCAACAGCAGCAACTTCAAGCCCTAAT AGCAGAAAAGAAAATGCAGCTAGAAAGGTATCGGGTTGAATATGAAGCTTTGTGTAAAGT AGAAGCAGAACAAAATGAATTTATTGACCAATTTATTTTTCAGAAATGAACTGAAAATTT CGCTTTTATAGTAGGAAGGCAAAACAAAAAAAAGCCTCTCAAAACCAAAAAAACCTCTGT AGCATTCCAGCGGCTTGACCAATGACCTATGTCACAAGAGGTGGCGTGTAAGGAATGCAG CCCCCTGAAGACAGCACTACAAGTCTGGGGGAGCCAGTTTTAACATCAGTGCACAGCTGC TGCTGGTGGCCCTGCAGTGTACGTTCTCACCTCTTATGCTTAGTTGGAACTAAGCAGTTT GTAAACTTTCATCCTTTTTTTTGTAAATTCACAAAGCTTTGGAAGGAGAAGCAATAAATT TTTGTTTTCAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_174887 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_174887.2, NP_777547.1 |
| RefSeq Size | 1016 bp |
| RefSeq ORF | 447 bp |
| Locus ID | 90410 |
| UniProt ID | Q8IY31 |
| Gene Summary | This gene encodes a intraflagellar transport protein important for intracellular transport. The encoded protein forms part of a complex involved in trafficking of proteins from the Golgi body, including recycling of immune signalling components (Finetti et al., PubMed: 19855387). This gene is part of a complex set of sense-antisense loci that may be co-regulated. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 14.[provided by RefSeq, Jun 2012] Transcript Variant: This variant (2) has multiple differences compared to variant 1. These differences result in a distinct 5' UTR, cause translation initiation at a downstream start codon, and result in a frameshift compared to variant 1. The encoded protein (isoform 2) is shorter than isoform 1 and has a distinct C-terminus. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201337 | IFT20 (Myc-DDK-tagged)-Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20) |
CNY 1200.00 |
|
| RC201337L1 | Lenti ORF clone of Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC201337L2 | Lenti ORF clone of Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20), mGFP tagged |
CNY 5890.00 |
|
| RC201337L3 | Lenti ORF clone of Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201337L4 | Lenti ORF clone of Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20), mGFP tagged |
CNY 5890.00 |
|
| RG201337 | IFT20 (tGFP-tagged) - Human intraflagellar transport 20 homolog (Chlamydomonas) (IFT20) |
CNY 2800.00 |
