Tau (MAPT) (NM_001123067) Human Untagged Clone
CAT#: SC318865
MAPT (untagged)-Human microtubule-associated protein tau (MAPT), transcript variant 5
CNY 12824.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DDPAC; FTDP-17; MAPTL; MSTD; MTBT1; MTBT2; PPND; PPP1R103; TAU; tau-40 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001123067 edited
ATGGCTGAGCCCCGCCAGGAGTTCGAAGTGATGGAAGATCACGCTGGGACGTACGGGTTG GGGGACAGGAAAGATCAGGGGGGCTACACCATGCACCAAGACCAAGAGGGTGACACGGAC GCTGGCCTGAAAGAATCTCCCCTGCAGACCCCCACTGAGGACGGATCTGAGGAACCGGGC TCTGAAACCTCTGATGCTAAGAGCACTCCAACAGCGGAAGCTGAAGAAGCAGGCATTGGA GACACCCCCAGCCTGGAAGACGAAGCTGCTGGTCACGTGACCCAAGCTCGCATGGTCAGT AAAAGCAAAGACGGGACTGGAAGCGATGACAAAAAAGCCAAGGGGGCTGATGGTAAAACG AAGATCGCCACACCGCGGGGAGCAGCCCCTCCAGGCCAGAAGGGCCAGGCCAACGCCACC AGGATTCCAGCAAAAACCCCGCCCGCTCCAAAGACACCACCCAGCTCTGGTGAACCTCCA AAATCAGGGGATCGCAGCGGCTACAGCAGCCCCGGCTCCCCAGGCACTCCCGGCAGCCGC TCCCGCACCCCGTCCCTTCCAACCCCACCCACCCGGGAGCCCAAGAAGGTGGCAGTGGTC CGTACTCCACCCAAGTCGCCGTCTTCCGCCAAGAGCCGCCTGCAGACAGCCCCCGTGCCC ATGCCAGACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAACCTGAAGCACCAG CCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTTAGCAACGTCCAGTCC AAGTGTGGCTCAAAGGATAATATCAAACACGTCCCGGGAGGCGGCAGTGTGCAAATAGTC TACAAACCAGTTGACCTGAGCAAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCAT CATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGA GTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAA AAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGG GCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGC AATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCCCCAGCTCGCCACGCTAGCT GACGAGGTGTCTGCCTCCCTGGCCAAGCAGGGTTTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001123067 |
Insert Size | 5724 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001123067.1, NP_001116539.1 |
RefSeq Size | 5724 bp |
RefSeq ORF | 5724 bp |
Locus ID | 4137 |
UniProt ID | P10636 |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, MAPK signaling pathway |
Gene Summary | This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) lacks four internal coding exons, as compared to variant 6. The reading frame is not affected, and the resulting isoform (5) has identical N- and C-termini but lacks four segments, as compared to isoform 6. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225648 | MAPT (Myc-DDK-tagged)-Human microtubule-associated protein tau (MAPT), transcript variant 5 |
CNY 5488.00 |
|
RC225648L1 | Lenti ORF clone of Human microtubule-associated protein tau (MAPT), transcript variant 5, Myc-DDK-tagged |
CNY 7888.00 |
|
RC225648L2 | Lenti ORF clone of Human microtubule-associated protein tau (MAPT), transcript variant 5, mGFP tagged |
CNY 5890.00 |
|
RC225648L3 | Lenti ORF clone of Human microtubule-associated protein tau (MAPT), transcript variant 5, Myc-DDK-tagged |
CNY 7888.00 |
|
RC225648L4 | Lenti ORF clone of Human microtubule-associated protein tau (MAPT), transcript variant 5, mGFP tagged |
CNY 7888.00 |
|
RG225648 | MAPT (tGFP-tagged) - Human microtubule-associated protein tau (MAPT), transcript variant 5 |
CNY 7088.00 |