ESE1 (ELF3) (NM_001114309) Human Untagged Clone

CAT#: SC318843

ELF3 (untagged)-Human E74-like factor 3 (ets domain transcription factor, epithelial-specific ) (ELF3), transcript variant 2



  "NM_001114309" in other vectors (6)

CNY 4940.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ELF3 mouse monoclonal antibody,clone OTI6G6
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EPR-1; ERT; ESE-1; ESX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318843 representing NM_001114309.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCAACCTGTGAGATTAGCAACATTTTTAGCAACTACTTCAGTGCGATGTACAGCTCGGAGGAC
TCCACCCTGGCCTCTGTTCCCCCTGCTGCCACCTTTGGGGCCGATGACTTGGTACTGACCCTGAGCAAC
CCCCAGATGTCATTGGAGGGTACAGAGAAGGCCAGCTGGTTGGGGGAACAGCCCCAGTTCTGGTCGAAG
ACGCAGGTTCTGGACTGGATCAGCTACCAAGTGGAGAAGAACAAGTACGACGCAAGCGCCATTGACTTC
TCACGATGTGACATGGATGGCGCCACCCTCTGCAATTGTGCCCTTGAGGAGCTGCGTCTGGTCTTTGGG
CCTCTGGGGGACCAACTCCATGCCCAGCTGCGAGACCTCACTTCCAGCTCTTCTGATGAGCTCAGTTGG
ATCATTGAGCTGCTGGAGAAGGATGGCATGGCCTTCCAGGAGGCCCTAGACCCAGGGCCCTTTGACCAG
GGCAGCCCCTTTGCCCAGGAGCTGCTGGACGACGGTCAGCAAGCCAGCCCCTACCACCCCGGCAGCTGT
GGCGCAGGAGCCCCCTCCCCTGGCAGCTCTGACGTCTCCACCGCAGGGACTGGTGCTTCTCGGAGCTCC
CACTCCTCAGACTCCGGTGGAAGTGACGTGGACCTGGATCCCACTGATGGCAAGCTCTTCCCCAGCGAT
GGTTTTCGTGACTGCAAGAAGGGGGATCCCAAGCACGGGAAGCGGAAACGAGGCCGGCCCCGAAAGCTG
AGCAAAGAGTACTGGGACTGTCTCGAGGGCAAGAAGAGCAAGCACGCGCCCAGAGGCACCCACCTGTGG
GAGTTCATCCGGGACATCCTCATCCACCCGGAGCTCAACGAGGGCCTCATGAAGTGGGAGAATCGGCAT
GAAGGCGTCTTCAAGTTCCTGCGCTCCGAGGCTGTGGCCCAACTATGGGGCCAAAAGAAAAAGAACAGC
AACATGACCTACGAGAAGCTGAGCCGGGCCATGAGGTACTACTACAAACGGGAGATCCTGGAACGGGTG
GATGGCCGGCGACTCGTCTACAAGTTTGGCAAAAACTCAAGCGGCTGGAAGGAGGAAGAGGTTCTCCAG
AGTCGGAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001114309
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001114309.1
RefSeq Size 3263 bp
RefSeq ORF 1116 bp
Locus ID 1999
UniProt ID P78545
Protein Families Transcription Factors
MW 41.5 kDa
Gene Summary Transcriptional activator that binds and transactivates ETS sequences containing the consensus nucleotide core sequence GGA[AT]. Acts synergistically with POU2F3 to transactivate the SPRR2A promoter and with RUNX1 to transactivate the ANGPT1 promoter. Also transactivates collagenase, CCL20, CLND7, FLG, KRT8, NOS2, PTGS2, SPRR2B, TGFBR2 and TGM3 promoters. Represses KRT4 promoter activity. Involved in mediating vascular inflammation. May play an important role in epithelial cell differentiation and tumorigenesis. May be a critical downstream effector of the ERBB2 signaling pathway. May be associated with mammary gland development and involution. Plays an important role in the regulation of transcription with TATA-less promoters in preimplantation embryos, which is essential in preimplantation development (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...