Dematin (DMTN) (NM_001114139) Human Untagged Clone

CAT#: SC318836

EPB49 (untagged)-Human erythrocyte membrane protein band 4.9 (dematin) (EPB49), transcript variant 6



  "NM_001114139" in other vectors (4)

CNY 5800.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DMTN rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DMT; EPB49
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318836 representing NM_001114139.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAACGGCTGCAGAAGGCCAAGATGGACAATCAGGTGCTGGGCTACAAGGACCTGGCTGCCATCCCC
AAGGACAAGGCCATCCTGGACATCGAGCGGCCCGACCTCATGATCTACGAGCCTCACTTCACTTATTCC
CTCCTGGAACACGTGGAGCTGCCTCGCAGCCGCGAGCGCTCGCTGTCACCCAAATCCACATCCCCCCCA
CCATCCCCAGAGGTGTGGGCGGACAGCCGGTCGCCTGGAATCATCTCTCAGGCCTCGGCCCCCAGAACC
ACTGGAACCCCCCGGACCAGCCTGCCCCATTTCCACCACCCTGAGACCTCCCGCCCAGATTCCAACATC
TACAAGAAGCCTCCCATCTATAAGCAGAGAGAGTCCGTGGGAGGCAGCCCTCAGACCAAGCACCTCATC
GAGGATCTCATCATCGAGTCATCCAAGTTTCCTGCAGCCCAGCCCCCAGACCCCAACCAGCCAGCCAAA
ATCGAAACCGACTACTGGCCATGCCCCCCGTCTCTGGCTGTTGTGGAGACAGAATGGAGGAAGCGGAAG
GCGTCTCGGAGGGGAGCAGAGGAAGAGGAGGAGGAGGAAGATGACGACTCTGGAGAGGAGATGAAGGCT
CTCAGGGAGCGTCAGAGAGAGGAACTCAGTAAGGTTACTTCCAACTTGGGAAAGATGATCTTGAAAGAA
GAGATGGAAAAGTCATTGCCGATCCGAAGGAAAACCCGCTCTCTGCCTGACCGGACACCCTTCCATACC
TCCTTGCACCAGGGAACGTCTAAATCTTCCTCTCTCCCCGCCTATGGCAGGACCACCCTGAGCCGGCTA
CAGTCCACAGAGTTCAGCCCATCAGGGAGTGAGACTGGAAGCCCAGGCCTGCAGATCTATCCCTATGAA
ATGCTAGTGGTGACCAACAAGGGGCGAACCAAGCTGCCACCGGGGGTGGATCGGATGCGGCTTGAGAGG
CATCTGTCTGCCGAGGACTTCTCAAGGGTATTTGCCATGTCCCCTGAAGAGTTTGGCAAGCTGGCTCTG
TGGAAGCGGAATGAGCTCAAGAAGAAGGCCTCTCTCTTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001114139
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001114139.3
RefSeq Size 2518 bp
RefSeq ORF 1077 bp
Locus ID 2039
UniProt ID Q08495
MW 40.7 kDa
Gene Summary The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (6) contains an alternate exon in the 5' UTR and lacks alternate in-frame exons in the 5' and 3' coding regions, compared to variant 1. Variants 6 and 17 encode the same isoform (3), which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...