VAX1 (NM_001112704) Human Untagged Clone
CAT＃: SC318830
VAX1 (untagged)-Human ventral anterior homeobox 1 (VAX1), transcript variant 1
CNY 3656.00
CNY 5420.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MCOPS11 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001112704 edited
ATGTTCGGGAAACCAGACAAAATGGACGTTCGATGCCACTCGGACGCCGAGGCTGCCCGG GTCTCGAAGAACGCGCACAAGGAGAGTCGGGAGAGCAAGGGCGCGGAGGGGAACCTCCCA GCCGCCTTCCTCAAGGAGCCGCAGGGCGCCTTCTCAGCGTCGGGCGCTGCTGAGGATTGT AACAAAAGTAAATCCAATTCCGCAGCGGACCCGGATTACTGCCGCCGGATCCTGGTCCGA GATGCCAAGGGGTCCATCCGAGAGATCATCCTGCCCAAGGGCCTGGACTTGGACCGGCCT AAGAGGACGCGCACGTCCTTCACCGCGGAGCAGCTCTATCGGCTGGAGATGGAGTTCCAG CGCTGCCAGTACGTGGTGGGCCGCGAGAGGACCGAGCTCGCCCGGCAGCTTAACCTCTCC GAGACCCAGGTGAAGGTCTGGTTCCAGAACCGGCGCACCAAGCAGAAGAAGGACCAGGGC AAGGACTCGGAGCTACGCTCGGTGGTGTCGGAGACCGCGGCCACGTGCAGCGTGCTACGG CTGCTGGAGCAGGGCCGCCTGTTGTCGCCGCCCGGCCTGCCTGCGCTGCTGCCGCCTTGC GCCACGGGCGCTCTCGGCTCAGCGCTGCGCGGGCCCAGCTTGCCGGCCCTGGGCGCGGGC GCCGCTGCAGGCTCGGCCGCCGCAGCCGCCGCCGCCGCCCCGGGCCCAGCGGGCGCTGCA TCCCCGCACCCGCCGGCTGTGGGCGGTGCTCCAGGTCCCGGGCCCGCCGGGCCGGGGGGA TTGCACGCAGGCGCCCCGGCCGCGGGCCACAGCCTCTTCAGCCTGCCGGTGCCCTCGCTG CTCGGCTCCGTCGCCAGCCGCCTGTCCTCCGCCCCGTTAACAATGGCTGGTTCGCTAGCT GGGAATTTGCAAGAACTCTCCGCCCGATATCTGAGCTCCTCGGCCTTCGAGCCTTACTCC CGGACCAACAATAAAGAAGGGGCCGAGAAAAAAGCGCTGGACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001112704 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001112704.1, NP_001106175.1 |
| RefSeq Size | 1968 bp |
| RefSeq ORF | 1005 bp |
| Locus ID | 11023 |
| UniProt ID | Q5SQQ9 |
| Protein Families | Transcription Factors |
| Gene Summary | This gene encodes a homeo-domain containing protein from a class of homeobox transcription factors which are conserved in vertebrates. Genes of this family are involved in the regulation of body development and morphogenesis. The most conserved genes, called HOX genes are found in special gene clusters. This gene belongs to the VAX subfamily and lies in the vicinity of the EMX homeobox gene family. Another member of VAX family is located on chromosome 2. The encoded protein may play an important role in the development of anterior ventral forebrain and visual system. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by orthologous data. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Deletion of Vax1 from Gonadotropin-Releasing Hormone (GnRH) Neurons Abolishes GnRH Expression and Leads to Hypogonadism and Infertility
,Hoffmann, HM;Trang, C;Gong, P;Kimura, I;Pandolfi, EC;Mellon, PL;,
J. Neurosci.
,PubMed ID 27013679
[VAX1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225487 | VAX1 (Myc-DDK-tagged)-Human ventral anterior homeobox 1 (VAX1), transcript variant 1 |
CNY 3656.00 |
|
| RC225487L3 | Lenti ORF clone of Human ventral anterior homeobox 1 (VAX1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC225487L4 | Lenti ORF clone of Human ventral anterior homeobox 1 (VAX1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG225487 | VAX1 (tGFP-tagged) - Human ventral anterior homeobox 1 (VAX1), transcript variant 1 |
CNY 4370.00 |
